ID: 916986077

View in Genome Browser
Species Human (GRCh38)
Location 1:170192326-170192348
Sequence GTGAGTGACTGTGCGACGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916986077_916986089 11 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986089 1:170192360-170192382 GGTGTGGTTGGGGGTTCCCTTGG No data
916986077_916986080 -10 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986080 1:170192339-170192361 AGTCACTCACCACTCCCTTTGGG No data
916986077_916986085 1 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986085 1:170192350-170192372 ACTCCCTTTGGGTGTGGTTGGGG No data
916986077_916986086 2 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986086 1:170192351-170192373 CTCCCTTTGGGTGTGGTTGGGGG No data
916986077_916986081 -5 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986081 1:170192344-170192366 CTCACCACTCCCTTTGGGTGTGG No data
916986077_916986083 -1 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986083 1:170192348-170192370 CCACTCCCTTTGGGTGTGGTTGG No data
916986077_916986084 0 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986084 1:170192349-170192371 CACTCCCTTTGGGTGTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916986077 Original CRISPR GTGAGTGACTGTGCGACGCT GGG (reversed) Intergenic
No off target data available for this crispr