ID: 916986079

View in Genome Browser
Species Human (GRCh38)
Location 1:170192338-170192360
Sequence CAGTCACTCACCACTCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916986075_916986079 16 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986079 1:170192338-170192360 CAGTCACTCACCACTCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916986079 Original CRISPR CAGTCACTCACCACTCCCTT TGG Intergenic
No off target data available for this crispr