ID: 916986080

View in Genome Browser
Species Human (GRCh38)
Location 1:170192339-170192361
Sequence AGTCACTCACCACTCCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916986077_916986080 -10 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986080 1:170192339-170192361 AGTCACTCACCACTCCCTTTGGG No data
916986075_916986080 17 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986080 1:170192339-170192361 AGTCACTCACCACTCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916986080 Original CRISPR AGTCACTCACCACTCCCTTT GGG Intergenic
No off target data available for this crispr