ID: 916986081

View in Genome Browser
Species Human (GRCh38)
Location 1:170192344-170192366
Sequence CTCACCACTCCCTTTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916986075_916986081 22 Left 916986075 1:170192299-170192321 CCAAGATCAATGGGAGAAGCATG No data
Right 916986081 1:170192344-170192366 CTCACCACTCCCTTTGGGTGTGG No data
916986078_916986081 -6 Left 916986078 1:170192327-170192349 CCAGCGTCGCACAGTCACTCACC No data
Right 916986081 1:170192344-170192366 CTCACCACTCCCTTTGGGTGTGG No data
916986077_916986081 -5 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986081 1:170192344-170192366 CTCACCACTCCCTTTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916986081 Original CRISPR CTCACCACTCCCTTTGGGTG TGG Intergenic
No off target data available for this crispr