ID: 916986089

View in Genome Browser
Species Human (GRCh38)
Location 1:170192360-170192382
Sequence GGTGTGGTTGGGGGTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916986077_916986089 11 Left 916986077 1:170192326-170192348 CCCAGCGTCGCACAGTCACTCAC No data
Right 916986089 1:170192360-170192382 GGTGTGGTTGGGGGTTCCCTTGG No data
916986078_916986089 10 Left 916986078 1:170192327-170192349 CCAGCGTCGCACAGTCACTCACC No data
Right 916986089 1:170192360-170192382 GGTGTGGTTGGGGGTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916986089 Original CRISPR GGTGTGGTTGGGGGTTCCCT TGG Intergenic
No off target data available for this crispr