ID: 916989267

View in Genome Browser
Species Human (GRCh38)
Location 1:170224857-170224879
Sequence TACCGGAGGCTGGTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916989257_916989267 30 Left 916989257 1:170224804-170224826 CCATGTTGTCACAAAAAAGTCAA No data
Right 916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916989267 Original CRISPR TACCGGAGGCTGGTGGGGAT GGG Intergenic
No off target data available for this crispr