ID: 916991640

View in Genome Browser
Species Human (GRCh38)
Location 1:170251025-170251047
Sequence TGCTCCAAGTGCAGGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916991626_916991640 24 Left 916991626 1:170250978-170251000 CCTGGGTGCTAAGTCCCTCTCTG No data
Right 916991640 1:170251025-170251047 TGCTCCAAGTGCAGGGCCGCGGG No data
916991633_916991640 9 Left 916991633 1:170250993-170251015 CCTCTCTGCAGGGGGCTGGCAGG No data
Right 916991640 1:170251025-170251047 TGCTCCAAGTGCAGGGCCGCGGG No data
916991632_916991640 10 Left 916991632 1:170250992-170251014 CCCTCTCTGCAGGGGGCTGGCAG No data
Right 916991640 1:170251025-170251047 TGCTCCAAGTGCAGGGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916991640 Original CRISPR TGCTCCAAGTGCAGGGCCGC GGG Intergenic