ID: 916995044

View in Genome Browser
Species Human (GRCh38)
Location 1:170287647-170287669
Sequence TCTCTGAGATAGGGCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916995039_916995044 18 Left 916995039 1:170287606-170287628 CCTACTTCTTTCACAGGTTTTAA No data
Right 916995044 1:170287647-170287669 TCTCTGAGATAGGGCTCCAGTGG No data
916995040_916995044 -5 Left 916995040 1:170287629-170287651 CCAGTGTTAAACCTGACTTCTCT No data
Right 916995044 1:170287647-170287669 TCTCTGAGATAGGGCTCCAGTGG No data
916995038_916995044 19 Left 916995038 1:170287605-170287627 CCCTACTTCTTTCACAGGTTTTA No data
Right 916995044 1:170287647-170287669 TCTCTGAGATAGGGCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916995044 Original CRISPR TCTCTGAGATAGGGCTCCAG TGG Intergenic