ID: 916996051

View in Genome Browser
Species Human (GRCh38)
Location 1:170302427-170302449
Sequence CAGTGGTTATAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916996051_916996057 -1 Left 916996051 1:170302427-170302449 CCTTCCTCACTCTATAACCACTG No data
Right 916996057 1:170302449-170302471 GCCACCCTCTACCCAGGCAGGGG No data
916996051_916996055 -3 Left 916996051 1:170302427-170302449 CCTTCCTCACTCTATAACCACTG No data
Right 916996055 1:170302447-170302469 CTGCCACCCTCTACCCAGGCAGG No data
916996051_916996064 17 Left 916996051 1:170302427-170302449 CCTTCCTCACTCTATAACCACTG No data
Right 916996064 1:170302467-170302489 AGGGGCCTAGATGTGAGCTTGGG No data
916996051_916996053 -7 Left 916996051 1:170302427-170302449 CCTTCCTCACTCTATAACCACTG No data
Right 916996053 1:170302443-170302465 ACCACTGCCACCCTCTACCCAGG No data
916996051_916996056 -2 Left 916996051 1:170302427-170302449 CCTTCCTCACTCTATAACCACTG No data
Right 916996056 1:170302448-170302470 TGCCACCCTCTACCCAGGCAGGG No data
916996051_916996063 16 Left 916996051 1:170302427-170302449 CCTTCCTCACTCTATAACCACTG No data
Right 916996063 1:170302466-170302488 CAGGGGCCTAGATGTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916996051 Original CRISPR CAGTGGTTATAGAGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr