ID: 916996870

View in Genome Browser
Species Human (GRCh38)
Location 1:170310510-170310532
Sequence GCTTAAATATAGTCTCCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916996870_916996876 10 Left 916996870 1:170310510-170310532 CCCTTAGGAGACTATATTTAAGC No data
Right 916996876 1:170310543-170310565 CTAATGGGTGCGATTTCACCAGG No data
916996870_916996875 -5 Left 916996870 1:170310510-170310532 CCCTTAGGAGACTATATTTAAGC No data
Right 916996875 1:170310528-170310550 TAAGCTGGGCTTTGACTAATGGG No data
916996870_916996874 -6 Left 916996870 1:170310510-170310532 CCCTTAGGAGACTATATTTAAGC No data
Right 916996874 1:170310527-170310549 TTAAGCTGGGCTTTGACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916996870 Original CRISPR GCTTAAATATAGTCTCCTAA GGG (reversed) Intergenic
No off target data available for this crispr