ID: 916998896

View in Genome Browser
Species Human (GRCh38)
Location 1:170333626-170333648
Sequence CTAGTTTGTGAGTGTTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916998892_916998896 28 Left 916998892 1:170333575-170333597 CCAAATAGTTTTAAAAGGACTCT No data
Right 916998896 1:170333626-170333648 CTAGTTTGTGAGTGTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916998896 Original CRISPR CTAGTTTGTGAGTGTTGCCC TGG Intergenic
No off target data available for this crispr