ID: 917001651

View in Genome Browser
Species Human (GRCh38)
Location 1:170367551-170367573
Sequence TGCACTGCAGGCTGCCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917001644_917001651 19 Left 917001644 1:170367509-170367531 CCTAGGCTGCTGGCAGAATTGTC No data
Right 917001651 1:170367551-170367573 TGCACTGCAGGCTGCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917001651 Original CRISPR TGCACTGCAGGCTGCCTCCA GGG Intergenic
No off target data available for this crispr