ID: 917003974

View in Genome Browser
Species Human (GRCh38)
Location 1:170391189-170391211
Sequence ATCTTTAGCTAGATGAACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917003974_917003975 17 Left 917003974 1:170391189-170391211 CCTTAGTTCATCTAGCTAAAGAT No data
Right 917003975 1:170391229-170391251 CTTTACAAAGAACAAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917003974 Original CRISPR ATCTTTAGCTAGATGAACTA AGG (reversed) Intergenic
No off target data available for this crispr