ID: 917007947

View in Genome Browser
Species Human (GRCh38)
Location 1:170436413-170436435
Sequence CCTAACCTTTAGTAGGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917007947_917007952 26 Left 917007947 1:170436413-170436435 CCATAAGCCTACTAAAGGTTAGG No data
Right 917007952 1:170436462-170436484 CTATTGCCTAATGTAGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917007947 Original CRISPR CCTAACCTTTAGTAGGCTTA TGG (reversed) Intergenic
No off target data available for this crispr