ID: 917009012

View in Genome Browser
Species Human (GRCh38)
Location 1:170449931-170449953
Sequence ATGTAGGTCTAGCAGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917009012_917009015 1 Left 917009012 1:170449931-170449953 CCCTCAGACTGCTAGACCTACAT No data
Right 917009015 1:170449955-170449977 GTAATACGAAGCACAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917009012 Original CRISPR ATGTAGGTCTAGCAGTCTGA GGG (reversed) Intergenic
No off target data available for this crispr