ID: 917020533

View in Genome Browser
Species Human (GRCh38)
Location 1:170581638-170581660
Sequence GAGCTACTGTGTTAAAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917020533_917020535 25 Left 917020533 1:170581638-170581660 CCATCATTTTAACACAGTAGCTC No data
Right 917020535 1:170581686-170581708 AAGTGACACTCAGTACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917020533 Original CRISPR GAGCTACTGTGTTAAAATGA TGG (reversed) Intergenic
No off target data available for this crispr