ID: 917021116

View in Genome Browser
Species Human (GRCh38)
Location 1:170588506-170588528
Sequence CTGTCTTTAGTTATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917021113_917021116 4 Left 917021113 1:170588479-170588501 CCTGTAAGGAAAAATGTCCAAAC No data
Right 917021116 1:170588506-170588528 CTGTCTTTAGTTATGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917021116 Original CRISPR CTGTCTTTAGTTATGCAGCC TGG Intergenic
No off target data available for this crispr