ID: 917021402

View in Genome Browser
Species Human (GRCh38)
Location 1:170592298-170592320
Sequence CATTGTGACTGAACTAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917021400_917021402 6 Left 917021400 1:170592269-170592291 CCATCTTATTTTTAATGACAGAC No data
Right 917021402 1:170592298-170592320 CATTGTGACTGAACTAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917021402 Original CRISPR CATTGTGACTGAACTAGAGA GGG Intergenic
No off target data available for this crispr