ID: 917027397

View in Genome Browser
Species Human (GRCh38)
Location 1:170659292-170659314
Sequence CAGAAGGAATGGTTGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917027388_917027397 30 Left 917027388 1:170659239-170659261 CCACTTACATAGGGATGAATTCA No data
Right 917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917027397 Original CRISPR CAGAAGGAATGGTTGGAAAG TGG Intergenic
No off target data available for this crispr