ID: 917033118

View in Genome Browser
Species Human (GRCh38)
Location 1:170716934-170716956
Sequence CTGCATTCTTGGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917033111_917033118 15 Left 917033111 1:170716896-170716918 CCTTTTGTACTGCTGAAGATACT 0: 1
1: 0
2: 0
3: 28
4: 335
Right 917033118 1:170716934-170716956 CTGCATTCTTGGGGAAAAACAGG 0: 1
1: 0
2: 0
3: 28
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917033118 Original CRISPR CTGCATTCTTGGGGAAAAAC AGG Intronic
905292090 1:36928782-36928804 CTGCATAATTGGGGACAAAGAGG - Intronic
905726040 1:40252871-40252893 TTGCCTTCCTGGAGAAAAACTGG + Intergenic
906249624 1:44301146-44301168 CTGCCTTCTTGGGGCTAACCCGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908879721 1:68717496-68717518 CTCCATTTTTGGGGAGAAAAAGG + Intergenic
912988928 1:114464349-114464371 CTGCATTCTTGGCGGCATACTGG + Exonic
913148212 1:116013224-116013246 CTGTGTGCTTGGGGAACAACAGG - Intronic
913181344 1:116325079-116325101 GGACATTCTTGTGGAAAAACAGG + Intergenic
913410769 1:118548675-118548697 AAGAATTCTTGGTGAAAAACTGG - Intergenic
914951809 1:152122330-152122352 CTAGATTGTTGGGGCAAAACAGG + Intergenic
915827473 1:159093341-159093363 CTGAATTCTGGGAGAAAAATTGG + Intronic
917033118 1:170716934-170716956 CTGCATTCTTGGGGAAAAACAGG + Intronic
917265111 1:173212447-173212469 CTGCATTCTTCTGGGAAATCCGG - Intergenic
917957239 1:180112038-180112060 CTGACTTCTTGGGGAAAGATGGG - Exonic
920408974 1:205743160-205743182 TTACATTTTTGGGAAAAAACAGG + Intronic
922694878 1:227724916-227724938 TTACCTTCTTGGGGAAAAAAGGG - Intergenic
924444211 1:244113660-244113682 CCGCATTCTTTGGGAGAGACAGG + Intergenic
1065052598 10:21811053-21811075 CTGCATTCCTGGGGAAAGTAGGG - Intronic
1069576037 10:69529068-69529090 CTCCAATCTTGGAGAAAATCTGG - Intergenic
1070282725 10:75061693-75061715 CTGCATTCTGGGCCAAAGACCGG - Intergenic
1071710414 10:88043851-88043873 CTGTTTTCTGGGGGAAAAGCTGG + Intergenic
1072852722 10:98913612-98913634 CTTCATTTTTGAGGAAAAAATGG + Intronic
1074231287 10:111538411-111538433 CTACATTCTGGGGGAAGAATTGG + Intergenic
1074917257 10:117969370-117969392 CTTCATCCTTGGTGACAAACAGG - Intergenic
1075272238 10:121062326-121062348 TTGCATTCGAGGGGAAAAACAGG + Intergenic
1076337343 10:129716676-129716698 CCCAATTCTTGGGGAAAAGCAGG - Intronic
1077629605 11:3802180-3802202 GTGCATACTTGTGGAAAGACTGG + Intronic
1078512626 11:11996969-11996991 CGGCATGCTTGGGCAGAAACTGG - Intronic
1080499477 11:32855211-32855233 CTACATTCTTAAGGAAAAACTGG - Exonic
1081097389 11:38955516-38955538 CTGCATGGTTGGGGAAAGATGGG - Intergenic
1082921039 11:58494019-58494041 GTTCATTATTGGGGAGAAACAGG - Intergenic
1084440688 11:69171076-69171098 CTGCACTTTGTGGGAAAAACAGG + Intergenic
1090657120 11:128854558-128854580 CTGCTTTCTTGGGTGACAACAGG + Intronic
1091989323 12:4941880-4941902 CTGCATTCATCTGGAAAGACAGG - Intergenic
1092040893 12:5383216-5383238 CTTAATTCTTGGGGAAACAAAGG + Intergenic
1093255335 12:16859466-16859488 ATGTATTATTGGGGAAAAACGGG - Intergenic
1094047791 12:26186252-26186274 CTGCATCCCTGGCTAAAAACTGG + Intronic
1095246219 12:39925857-39925879 CTGTATTACTGGGGAAAGACTGG - Intronic
1096517526 12:52165359-52165381 CTGCATTCTTGGCGCACTACCGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101777394 12:107806823-107806845 CTTTATTCTGGGGGAAAACCTGG + Intergenic
1102227312 12:111237843-111237865 CTGCATTCAGGGGGAGAAACGGG - Intronic
1103445180 12:120989775-120989797 CTGCCTTCCTGAGGAAGAACAGG - Intronic
1104400327 12:128470641-128470663 CTGCATGTATGGGGAATAACTGG + Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1105811533 13:24000512-24000534 CTGCCTTCTAGGGGGAAGACAGG + Intronic
1106656601 13:31753249-31753271 CTGGATTATTGGGAAACAACAGG - Intronic
1106711008 13:32332915-32332937 CTGCATTCTTGCAGTAAAGCAGG + Exonic
1107525800 13:41230124-41230146 CTTCATTTTTGGGGAAAAAATGG + Intronic
1109981029 13:69907612-69907634 CTGTATTCTGTGGGAAAAATTGG + Intronic
1110591949 13:77273539-77273561 GTGGCTTCTTGGGGAGAAACAGG - Exonic
1114496628 14:23137406-23137428 CTGCATTCTTGGGGCAATCAGGG + Intronic
1116275414 14:42826207-42826229 CTTGATTCTTGGGGATAAACAGG + Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116384717 14:44316238-44316260 CTGCCTTTTTGGGTAAGAACTGG - Intergenic
1117219630 14:53589998-53590020 ATGCGTTGTAGGGGAAAAACGGG + Intergenic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1121441155 14:93950287-93950309 AGGCATTCTTGGGGAAGATCAGG + Intronic
1121923366 14:97904429-97904451 CTTCCTTCATGGGAAAAAACAGG - Intergenic
1122345560 14:101056648-101056670 CAGCATTCTTGGGGACTCACTGG + Intergenic
1125066840 15:35497610-35497632 CTGTATTATTGGGGAAGAAAAGG + Intronic
1125970284 15:43905874-43905896 CTGAATGTTTAGGGAAAAACTGG + Exonic
1128062699 15:64745282-64745304 CTGCATTTATGGAAAAAAACAGG - Intronic
1129668458 15:77592860-77592882 CTGCATTGTTGGGGGAAGGCCGG - Intergenic
1131073426 15:89479984-89480006 GGGCATTCTAGGGGAAATACAGG + Intronic
1132999861 16:2843812-2843834 CTGCAGTCTTGGGCAAATTCAGG - Intergenic
1135350839 16:21727761-21727783 CTGCATCCCTGGGGAAGATCAGG + Intronic
1137382629 16:48013103-48013125 AGGCATTCTTGAGGAACAACAGG - Intergenic
1138685673 16:58723537-58723559 GTTCAATCTTGGGAAAAAACAGG + Intronic
1140240589 16:73196302-73196324 TTGCAGTCTTGAGGAAAATCTGG - Intergenic
1140979542 16:80093623-80093645 CTGCTTTCTTGGGGCAAACCTGG - Intergenic
1142134136 16:88443931-88443953 CTGCAGTCTTGGGGCAAACTGGG - Intergenic
1143232794 17:5371656-5371678 CTGCATTCTGAAGGACAAACAGG - Intronic
1143398763 17:6626470-6626492 CTGCATGGTAGGGGAAAATCCGG + Intronic
1144286667 17:13782115-13782137 CAGAATTTTTGGGTAAAAACAGG - Intergenic
1144759503 17:17699431-17699453 CTGCAATTTTGGGGCAAAATAGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1147370151 17:39986956-39986978 GTACATTCTTGGGGAAAAGTAGG + Intronic
1147405930 17:40212151-40212173 TTGCATTCTTGGAAAAAAACAGG - Intergenic
1148052165 17:44774750-44774772 GTGAGTTCTTGGGGACAAACCGG + Intronic
1150138218 17:62707317-62707339 CTGCATGTTTGGGGAAAGTCAGG - Intronic
1150560233 17:66288299-66288321 CTGGATTCTTGGGCACAAAGAGG + Intergenic
1152975866 18:217780-217802 CGGCAACCTTGGGGAAAAAGTGG + Intronic
1156870374 18:41938789-41938811 CTGCTTTATGGGGGAAAAGCAGG - Intergenic
1157104432 18:44759995-44760017 CTGCATGCTTGTGGAGAACCTGG + Intronic
1157473130 18:48005005-48005027 CTGCTTTCTTGAGGAAATCCAGG - Intergenic
1158442411 18:57488764-57488786 CTGCCCTCTTGGGGAAACATGGG + Exonic
1161309028 19:3583754-3583776 CTCCAGTCCTGGGGACAAACAGG + Intergenic
1162593818 19:11611854-11611876 CTCCTGTTTTGGGGAAAAACTGG + Intronic
1162694850 19:12466508-12466530 CTGCATTTTAGGGGAAAACTGGG - Exonic
1162714924 19:12624639-12624661 CTACATTTTAGGGGAAAAATGGG + Exonic
1162880379 19:13654485-13654507 CTGCCTTTTTGTGTAAAAACTGG + Intergenic
1163524566 19:17812801-17812823 CTGAATTCTTGGGGAACACAGGG - Exonic
1165635976 19:37340460-37340482 CTGCAATGTTGGGGAAAACGAGG - Intronic
1165679476 19:37761536-37761558 CTGCCTTTTTGGGTAAAAACTGG + Intronic
1166635371 19:44446831-44446853 CTACATTCTTGTTGGAAAACAGG - Intronic
1167694430 19:51006498-51006520 CTGCATGCCTGGGGAGACACAGG + Exonic
925830837 2:7894131-7894153 CTGCTTTTTTGTGTAAAAACTGG + Intergenic
927815714 2:26215473-26215495 CTGCATTCTTGCTGCAAAACTGG + Intronic
928660401 2:33495965-33495987 CTAGATTCTTGTGGAAAAATTGG - Intronic
928861569 2:35863521-35863543 CTGCATTCTTCTGGAATAACAGG - Intergenic
929858169 2:45652599-45652621 CTTCATAGTTGGGGAGAAACAGG + Intronic
930298180 2:49581061-49581083 CTGAATTTTTGTGGAAATACTGG + Intergenic
930308721 2:49710760-49710782 CTGCATTCTTGCAAAAAATCAGG - Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
934571085 2:95373868-95373890 CTCCATTCCTGGGGAAAGTCAGG + Intronic
935120848 2:100182411-100182433 CTGCAGTCTCGGGGAAAACGGGG - Intergenic
937873332 2:126802223-126802245 CTGCCTTCTTTGGGAAACCCAGG + Intergenic
940002787 2:148983448-148983470 CTGCATTCTTGGATAAGAAGGGG - Intronic
940404503 2:153284861-153284883 CTGCCATCTTGGGCAAAAAAGGG + Intergenic
941109160 2:161398647-161398669 CTACATGCTTGGGAAAAAAAAGG - Intronic
942433708 2:175946553-175946575 CTGCATTTTTGAAGGAAAACAGG + Intronic
943187133 2:184624745-184624767 CAACATTCTTGGTGAAAAGCTGG + Intronic
943953474 2:194158665-194158687 GTGCATACTTTTGGAAAAACTGG - Intergenic
1172630155 20:36372867-36372889 GCGCATTGTTGGGGAAAAACAGG + Intronic
1173085678 20:39914219-39914241 CTACATTTTAGGGGAAAAAAAGG + Intergenic
1173302115 20:41813136-41813158 GTGCATTCTGAGTGAAAAACAGG - Intergenic
1174188991 20:48726662-48726684 CTGAGTTGTTGGGGAAAAAAAGG + Intronic
1174655996 20:52172660-52172682 CTGCATTCTCGGTGAAAAGAGGG - Intronic
1175556626 20:59864912-59864934 CTGCATTCTGGGGGGAAATGTGG - Intronic
1175611222 20:60352819-60352841 CTGCATCCTTGGGAAGCAACAGG - Intergenic
1179567633 21:42259080-42259102 CTGTGTTCTTGGGGGAAAACAGG - Intronic
1180592432 22:16952574-16952596 TTCCATTCTTTGGGAAAAAATGG + Intergenic
1181627370 22:24130964-24130986 CTCCAATCTGGGGGACAAACTGG + Intronic
1182830563 22:33301644-33301666 CAGCATTCTTGGGAAAAGTCTGG + Intronic
1183922322 22:41178685-41178707 CTGCATCCTTGGGGAAGGACTGG - Exonic
949639665 3:6021685-6021707 CTGAATGCTGGGGGAAATACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952626982 3:35417608-35417630 TTCCATTCTCGTGGAAAAACGGG - Intergenic
956260291 3:67331865-67331887 CTGCATTCTTTGGAGTAAACTGG + Intergenic
956756794 3:72396220-72396242 GTGCATTCTGGGCAAAAAACTGG - Intronic
957469423 3:80639112-80639134 CTACATACTTCGGGGAAAACGGG + Intergenic
958469031 3:94495308-94495330 ATGCAGCCTTGGGGAAAGACAGG + Intergenic
958915524 3:100045981-100046003 CTGCATTCTTGGTGGAAAAATGG + Intronic
959430542 3:106250157-106250179 CTGCATTCTGTTGGAAAATCTGG + Intergenic
961146843 3:124601150-124601172 CTGCGCACTTGGGGAAATACAGG + Intronic
961263221 3:125619182-125619204 CTGCAGTCTGGGGGAGAAGCCGG - Intergenic
961736844 3:129007326-129007348 CTGCATTCTAGAGGAATTACCGG + Intronic
961925214 3:130472222-130472244 CTGCATCCTTGTGCAAAATCGGG + Intronic
964609031 3:158590325-158590347 CTGCATTCTTGGTGAAATATAGG - Intronic
965107817 3:164380464-164380486 CTGCATTCCTGTGTAAAAACTGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966089440 3:176114823-176114845 CTGCTTTCTTGGTGGAAAAGTGG + Intergenic
967771974 3:193344095-193344117 CTTCATTCTTAAGTAAAAACAGG - Intronic
968275935 3:197440203-197440225 CTGCCATCTTGGGGAAGAACAGG + Intergenic
973143424 4:46796299-46796321 CTGCATAAATGGGCAAAAACTGG - Intronic
974921917 4:68252456-68252478 CTGCATACTGGAGGAAAGACAGG - Intergenic
975409291 4:74030529-74030551 CTGTATTATGGGGGAAAACCTGG - Intergenic
975855314 4:78618141-78618163 CTTCTTTCTTCAGGAAAAACAGG + Intergenic
978099460 4:104820028-104820050 CTGCATCTATGGGCAAAAACTGG + Intergenic
978818884 4:112941813-112941835 ATGTATGCATGGGGAAAAACTGG + Intronic
981026784 4:140084881-140084903 ATGCATTGTAGGGGAAAAAAAGG - Intronic
981131198 4:141160335-141160357 CTGCATTACTGGGGAAATGCTGG + Intronic
981242733 4:142497557-142497579 ATGCTTTATTGGGGAAACACAGG + Intronic
981768668 4:148281204-148281226 CAGCAGACTTGGGGAAAAAGCGG + Intronic
984043347 4:174765634-174765656 CTAGATTCTTGTGGAAAAATTGG - Intronic
985650047 5:1103212-1103234 CTGCCTTCTGAGGGAAAAACAGG + Intronic
986163723 5:5253848-5253870 CCGCATTCATGGGAATAAACAGG - Intronic
988455476 5:31383578-31383600 GGGCAGTCTTGAGGAAAAACTGG + Intergenic
990342450 5:54836778-54836800 CAGCATTCAAGGTGAAAAACTGG + Intergenic
992663875 5:78986561-78986583 AAGGATTCTTGGGGAAAAAAAGG - Intergenic
993274388 5:85837840-85837862 ATGCATACTTGAGAAAAAACAGG - Intergenic
995328244 5:110916759-110916781 CAGCATTCAAGGGGAAAACCAGG + Intergenic
996024271 5:118626594-118626616 CTATTTTCTTGGGGAAAAAAAGG + Intergenic
997261528 5:132469089-132469111 CTGGATTATTGGGTAGAAACTGG + Intronic
999182685 5:149681144-149681166 TTGCATTCTTGGGGAATCAAAGG + Intergenic
999426195 5:151489577-151489599 AGGCATTCTGGGGGAAAGACAGG - Exonic
999891015 5:155978779-155978801 CTGCATTCTTTTGGAAGAAATGG - Intronic
1002176781 5:177405138-177405160 TCTCATTCTTGTGGAAAAACCGG + Exonic
1004229547 6:13818698-13818720 CTGCATTCAGGTGGAAAGACAGG - Intergenic
1004482058 6:16030442-16030464 CAGAAATCTTGGGGAAAAAAAGG - Intergenic
1004825394 6:19414901-19414923 CTGCTTTCTTTGAGACAAACAGG + Intergenic
1005475419 6:26203263-26203285 CTGCCTTTTTGTGTAAAAACTGG - Intergenic
1006175578 6:32119488-32119510 CTGCCTCCTAGGGGAAAATCAGG - Intronic
1007298112 6:40844055-40844077 GAGCAGGCTTGGGGAAAAACGGG + Intergenic
1007862909 6:44932857-44932879 GTGCATCCTAAGGGAAAAACCGG - Intronic
1010562514 6:77368442-77368464 CTGAATTCAGGGGGAAAAACAGG - Intergenic
1011087841 6:83562339-83562361 TTGCATTCCTGGGTAAAACCTGG - Intronic
1011189010 6:84711438-84711460 CTGCTTTCTTAGGGAAGAAAAGG + Intronic
1011751848 6:90461799-90461821 CTGCCTTCTTTGTGAAGAACTGG - Intergenic
1013080054 6:106804622-106804644 CCGCATTCCTGGAGAGAAACAGG + Intergenic
1014656727 6:124114797-124114819 CTACATTCTTAGGGAACAAAAGG + Intronic
1016088589 6:139946355-139946377 CTAATTTCTTGGGGAAAAATTGG - Intergenic
1016322100 6:142857639-142857661 CTGAAGTTTTGGAGAAAAACAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1021422430 7:20460825-20460847 CTGCATTTTTGAGTAAAAACTGG + Intergenic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028510012 7:91614174-91614196 TTGCCTTCTTTGGGAAAAAAGGG - Intergenic
1029026238 7:97419657-97419679 CTGAAGTCTTAGGGAAAAGCAGG + Intergenic
1032909015 7:136407722-136407744 CTGCAATACTGGGGACAAACTGG - Intergenic
1034985336 7:155509756-155509778 CTGCTTTCTTTGGGAACAGCTGG + Intronic
1035324687 7:158057339-158057361 CGTCAAACTTGGGGAAAAACAGG + Intronic
1037270524 8:17124826-17124848 CTGATTTCTTGGGAACAAACTGG - Intergenic
1038686654 8:29724986-29725008 CAGTCTTCTTGGGGAAAAAGAGG - Intergenic
1038933830 8:32225501-32225523 CTACATTCTTGGGGAAGACCAGG + Intronic
1041342811 8:56864062-56864084 CTGCACTGTTCTGGAAAAACTGG + Intergenic
1045679610 8:104644631-104644653 TGGCATTCATGGGGAAAGACCGG - Intronic
1045710586 8:104978798-104978820 CTGCTTTCTGGGGGAAAGTCTGG + Intronic
1048170954 8:132105727-132105749 CTGCATTATTGCAGGAAAACTGG + Intronic
1048956931 8:139544897-139544919 TTACATCCTTGGGGCAAAACAGG - Intergenic
1049892940 9:87763-87785 GTGCATTCTGGGGGAAAAAATGG + Intergenic
1050206454 9:3201397-3201419 CTGCCCACTTGGGGAAAAAAAGG - Intergenic
1051823566 9:21194113-21194135 CTGCAAACGTGGGGAAATACAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052926887 9:34024601-34024623 CTGAAATCTTCTGGAAAAACGGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058211623 9:102176887-102176909 CTCCATTGTGGGGGAAAAAAAGG - Intergenic
1059319874 9:113461308-113461330 CTGCCTTCTTGGGGAAAGCAGGG + Intronic
1059589756 9:115645944-115645966 CTGCATTGTTTGGTAAATACAGG + Intergenic
1185828470 X:3275773-3275795 CTGCTTTCTTGGGAAAAACTTGG - Intronic
1187136600 X:16553338-16553360 CTATATTCATGGGGAAAAAAAGG + Intergenic
1187671182 X:21667458-21667480 CAGCATTCTTGGGGCAATACTGG - Intergenic
1187882453 X:23859838-23859860 CTGCTCTCTTAGGGAAAAAAAGG - Intronic
1188937401 X:36193552-36193574 CTGAATTCCTGGGGAAACATAGG + Intergenic
1190885302 X:54526409-54526431 CTGCATTTTTGGGGATAATTGGG + Intergenic
1191062755 X:56317298-56317320 CTGCCTTCTTCCGGCAAAACAGG + Intergenic
1192862639 X:75093665-75093687 CTGCATTCTGGAGAAAAAAAGGG + Intronic
1196784497 X:119410140-119410162 CTGCTGTCTTGGGAAAACACTGG - Intronic
1198136243 X:133753499-133753521 CTGCATTCTTCTGGACATACTGG + Exonic
1198461654 X:136868851-136868873 CTTACCTCTTGGGGAAAAACAGG - Intronic
1201267430 Y:12221470-12221492 CTGCCTTTCTGGGTAAAAACTGG + Intergenic
1201641869 Y:16188161-16188183 CTGCATTCTGGTGAAAAAGCTGG - Intergenic
1201660946 Y:16397160-16397182 CTGCATTCTGGTGAAAAAGCTGG + Intergenic
1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG + Intergenic
1202213536 Y:22472519-22472541 CTGCAATCCTGGGGAAAAAATGG - Intergenic