ID: 917033486

View in Genome Browser
Species Human (GRCh38)
Location 1:170720911-170720933
Sequence GAACACTACTTGGCATATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917033486_917033490 24 Left 917033486 1:170720911-170720933 CCCTTATATGCCAAGTAGTGTTC 0: 1
1: 0
2: 1
3: 32
4: 213
Right 917033490 1:170720958-170720980 CTCACACCAATTCAGTGATGTGG 0: 1
1: 0
2: 1
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917033486 Original CRISPR GAACACTACTTGGCATATAA GGG (reversed) Intronic
901128345 1:6945110-6945132 GAGCAGTATTTGGCATATGATGG + Intronic
902998174 1:20243777-20243799 GAACACTTCTTGGCAATTAAGGG - Intergenic
906623334 1:47303760-47303782 CAACACTAGTTGGCAGAGAAGGG - Intronic
907754225 1:57294613-57294635 GCATAATACTTGGCAAATAATGG - Intronic
908194278 1:61733724-61733746 AAAATGTACTTGGCATATAAAGG - Intergenic
909378296 1:74966667-74966689 ACACAGTACTTGGCATATATGGG - Intergenic
910448055 1:87318829-87318851 GAACATTGGTTGGCACATAATGG + Intergenic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
911632279 1:100196730-100196752 GAAGAATACTTGGCACATAGTGG - Intronic
911645491 1:100333413-100333435 GAACAGTACCTGGCACATAATGG - Intergenic
912739952 1:112185105-112185127 CAACAGTGCTTGGCATATAGTGG + Intergenic
913311324 1:117498440-117498462 GCATAATACTTGGCATATAATGG - Intronic
914785680 1:150827513-150827535 GAATACTACTGAGCATAAAAAGG - Intronic
914977944 1:152383240-152383262 CAACACTATTTGGCAAAAAAAGG - Intergenic
916812707 1:168319480-168319502 GAATATTACTTGGCAGAAAAAGG - Intergenic
917033486 1:170720911-170720933 GAACACTACTTGGCATATAAGGG - Intronic
919362843 1:196616657-196616679 TAATACTACCTGGCACATAATGG - Intergenic
919708977 1:200707422-200707444 GAACAGATCTTGGCATAGAATGG - Intergenic
921078245 1:211717106-211717128 GAATACTACTTGGCTATTAAAGG - Intergenic
921667223 1:217887533-217887555 GAACAGTGCCTGGCATAGAAGGG - Intergenic
921832252 1:219741282-219741304 GAACATTCCTTGGAATAAAATGG + Intronic
921848543 1:219909257-219909279 GAACAGTACCTGGCACATAGTGG - Intronic
922343425 1:224676141-224676163 GAATACTACTTGGCAGTAAAAGG + Intronic
922995068 1:229950489-229950511 GAATACTACTTGGCCATTAAAGG - Intergenic
1063397118 10:5699129-5699151 GAATATTATTTGGCATAAAAAGG + Intronic
1064239100 10:13608761-13608783 GCACAGGACTTGGCATACAAAGG - Intronic
1064335309 10:14435311-14435333 GAACAGTACCTGGCATATATGGG - Intronic
1065248820 10:23788341-23788363 GAGAACTCCTTGGCAAATAAAGG - Intronic
1069332938 10:67314976-67314998 GAACACTACTTGAAATCTCAAGG - Intronic
1069402108 10:68060145-68060167 GCACAGTACCTGGCATATAATGG + Intronic
1070005149 10:72417040-72417062 GAAGACTGCTTGGCACATAGTGG + Intronic
1072329734 10:94335999-94336021 GAACACTAGTAGGCATAAATGGG - Intronic
1073498611 10:103916868-103916890 GAACAGTGCCTGGCATATAGTGG - Intronic
1073700498 10:105921362-105921384 GAGCAATAATAGGCATATAATGG - Intergenic
1074194492 10:111169816-111169838 GAACATTACCAGGAATATAAAGG - Intergenic
1075180770 10:120208907-120208929 GAACACTACCTGGCAAACCATGG + Intergenic
1078675354 11:13407492-13407514 GCACAGTGCTGGGCATATAATGG + Intronic
1078969597 11:16392338-16392360 GAACAGTGCCTGGCATATAGTGG - Intronic
1079893804 11:26093191-26093213 ACACACTACTGGGCATATACTGG - Intergenic
1080526521 11:33126787-33126809 CAATAATGCTTGGCATATAATGG - Intronic
1081069603 11:38595035-38595057 GAACTCTCCTAGGCAGATAAAGG + Intergenic
1081976776 11:47240290-47240312 GAACAGTAGCTGGCATATGATGG - Intronic
1086155865 11:83665314-83665336 GCACACTACTTGACATAAGAAGG - Intronic
1086529563 11:87768777-87768799 GAACAATACCTGACATATAGAGG + Intergenic
1090502420 11:127274519-127274541 GAACAAGACTTGGCAAATACTGG + Intergenic
1090816567 11:130302110-130302132 GAACAATACTTGGCACATATTGG - Intronic
1091965973 12:4742165-4742187 GAACACTAGCTAGCATGTAATGG - Intronic
1094546988 12:31413635-31413657 GAACAGTACTGGGCACAGAAAGG + Intronic
1094704506 12:32901033-32901055 GCAGACTACCTAGCATATAATGG - Intergenic
1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG + Intergenic
1097656457 12:62369448-62369470 AAAAACCAGTTGGCATATAAAGG - Intronic
1097788966 12:63793796-63793818 GAACACAATTTGTCATAGAATGG + Intronic
1098219817 12:68257239-68257261 GAACAGTGCCTGGCATATAGTGG + Intergenic
1098608641 12:72426659-72426681 TAACACTACCTAACATATAAAGG - Intronic
1099705921 12:86152713-86152735 GAACAGTACCTGGTATGTAATGG - Intronic
1100277054 12:93081060-93081082 GAACAGTATCCGGCATATAAGGG + Intergenic
1100511370 12:95277788-95277810 GAACAGGGCTTGACATATAATGG + Intronic
1100533280 12:95480233-95480255 GAATACTACTTGCAATAAAAAGG - Intronic
1100736479 12:97539938-97539960 GAACTCTAATTGGCATGTGAGGG + Intergenic
1101194338 12:102367540-102367562 GAATAGTACTGGGCACATAATGG + Intergenic
1101549709 12:105750563-105750585 GAACAATCCTTGGCACATATTGG - Intergenic
1101783449 12:107860159-107860181 GAATACTACTTGGCAGTTAAAGG - Intergenic
1105480155 13:20767715-20767737 GAAGATTACTTGGGAAATAATGG - Intronic
1106196127 13:27495486-27495508 GAATACTACTCAGCATTTAAAGG + Intergenic
1106345707 13:28875060-28875082 GCACAGTACTTGGTACATAATGG + Intronic
1106345713 13:28875185-28875207 GCACAGTACTTGGTACATAATGG + Intronic
1106345719 13:28875308-28875330 GCACAGTACTTGGTACATAATGG + Intronic
1107664922 13:42679003-42679025 GAACATTACTTGCCATGTACTGG + Intergenic
1108333805 13:49418195-49418217 GAACATTATTTGGCAAAAAAAGG + Intronic
1109601278 13:64632895-64632917 GAAAATTGCTTAGCATATAAAGG - Intergenic
1110445430 13:75574638-75574660 GAATAGTACCTGGCATTTAATGG + Intronic
1111630965 13:90845747-90845769 GAACACTACTCAGCTTAGAAAGG - Intergenic
1111836745 13:93397632-93397654 GCACAGTACCTGGCACATAAAGG - Intronic
1111948545 13:94691206-94691228 GAAGACTGCTTGGGATGTAAAGG + Intergenic
1116041231 14:39688335-39688357 GAATACTGCTTGCCACATAATGG + Intergenic
1117527511 14:56624592-56624614 GCACACTGCCTGGCATAGAACGG - Intronic
1124254022 15:28126536-28126558 GAATACTACTAGCCATAAAAAGG + Intronic
1125378278 15:39057924-39057946 GAATACTACTCAGCATAAAAGGG + Intergenic
1125908896 15:43418544-43418566 GAACATGGATTGGCATATAATGG - Intronic
1127013296 15:54654073-54654095 GAGCACGACTTGGCATATTAAGG - Intergenic
1128888886 15:71313011-71313033 GAACAGTGCCTGGCATATAACGG + Intronic
1131206029 15:90448228-90448250 GACAACTACTTGGCATTTTAAGG + Intronic
1132263800 15:100448764-100448786 GCACACTACTGGGGATATCAGGG - Intronic
1133861909 16:9603999-9604021 GAACACTGCTTAGCACATATAGG - Intergenic
1135150843 16:20004315-20004337 GGACAGTACATGGCACATAAAGG - Intergenic
1138145492 16:54605554-54605576 CAAAATTACTTGGCATATAAAGG + Intergenic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1144438900 17:15263830-15263852 GCAAAGTGCTTGGCATATAACGG - Intronic
1144456270 17:15421597-15421619 GAACAATACCTGGCATGTAGCGG - Intergenic
1149055608 17:52359965-52359987 TAACAGTTCTTGGCATATATTGG + Intergenic
1149335957 17:55636207-55636229 GAAAACTAATTGGCTGATAATGG - Intergenic
1151339982 17:73464978-73465000 GAACAGTGCTTGGCATATGGGGG + Intronic
1151895636 17:76978810-76978832 AAACACTCTTTGGCATACAAAGG - Intergenic
1155082375 18:22423544-22423566 GAACGCTGCTTGGCACATATGGG - Intergenic
1155777465 18:29784852-29784874 GAACATGAGTTAGCATATAAAGG + Intergenic
1157828192 18:50831448-50831470 GCACAGTACTTGGCACATGATGG + Intergenic
1159030921 18:63230615-63230637 AAACACTATTAGGCATAAAATGG + Intronic
1159907032 18:74102761-74102783 GAATACTACTCAGCATAAAAAGG + Intronic
1160301435 18:77684317-77684339 GAACAATACCTGGCATATATAGG - Intergenic
1165225997 19:34355694-34355716 GAAGACCACTTGGGATATTACGG + Intergenic
1165338837 19:35195753-35195775 CAAAATTACTTGGCATACAAAGG - Intergenic
1166576624 19:43846628-43846650 GACCACAACTGGGCACATAAGGG + Intronic
1167528188 19:49998617-49998639 GAATAATACTCAGCATATAATGG - Intronic
927060854 2:19417852-19417874 CAACAGTACTGGGCATGTAAAGG - Intergenic
928555792 2:32423631-32423653 GAATATTATTTGGCATAAAAAGG - Intronic
928953123 2:36832671-36832693 GAACACTACTCGCCATAAAAAGG - Intergenic
930340489 2:50107839-50107861 GAACAGTATTTGGCTCATAATGG + Intronic
931095131 2:58931158-58931180 ACACATTACTTGGCATATAGTGG - Intergenic
932650367 2:73549159-73549181 GAACATTTCTGGACATATAAAGG - Intronic
936363215 2:111826539-111826561 GAATACTACTTAGCATGAAAAGG - Intronic
936980509 2:118260820-118260842 GCAGAATGCTTGGCATATAACGG - Intergenic
939303837 2:140383696-140383718 GAAGACTAGTAGGCATATATGGG - Intronic
939884950 2:147671455-147671477 GAACACTGCCTGGCATATATTGG - Intergenic
939994770 2:148909516-148909538 GAACAGTACTTGGCACATGGAGG + Intronic
941460149 2:165761088-165761110 GCAGACTCCTTGGCATAAAAAGG - Intronic
943560315 2:189453638-189453660 CTTCAGTACTTGGCATATAATGG + Intronic
944190853 2:197002334-197002356 GAACAGTTCTTGGCACATCATGG + Intronic
946581727 2:221135617-221135639 GAACAATGCCTGGCATATAGGGG + Intergenic
1169948324 20:11013574-11013596 CAGCACTACTTGGCTTATAGTGG - Intergenic
1170066483 20:12316271-12316293 GAACACCACTAGGAATAAAAAGG - Intergenic
1170379140 20:15737256-15737278 AAACACTAGTTGGCATGTGAGGG + Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173773964 20:45687348-45687370 GAATACTATGTGGCATAAAAAGG - Intronic
1174940823 20:54924872-54924894 AAACTGTACTTGGCATATACAGG - Intergenic
1175496511 20:59418240-59418262 GCACAGTGCTTGGCATATAGTGG - Intergenic
1179050840 21:37887428-37887450 GAACAGTAACTGGCCTATAAGGG - Intronic
1182794324 22:32979696-32979718 GAACAGTACCTGGCACATACTGG - Intronic
1184267946 22:43359940-43359962 GAACAGTGCTTGGCATATAGTGG - Intergenic
949216240 3:1571601-1571623 GAACACTACCTGAAATAAAAAGG - Intergenic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
950316635 3:12006486-12006508 GTACAGCATTTGGCATATAATGG - Intronic
950982869 3:17327856-17327878 GAACAGTACCTGGTATACAATGG + Intronic
951008437 3:17647217-17647239 GAACTATACTTGGCACATGATGG - Intronic
951564336 3:23997983-23998005 GAACAGTTCTTAGCACATAATGG + Intergenic
951619053 3:24580762-24580784 GAACACTGCTTGGGAGATGATGG - Intergenic
952157140 3:30655699-30655721 CAGCACTACTTGGCCAATAATGG - Intronic
952961507 3:38593891-38593913 GAACACTACTTGGAATACTGAGG + Intronic
953216135 3:40920717-40920739 GAAAAGTACTGGGCATATCACGG - Intergenic
954806381 3:53223357-53223379 GAACACTGCTAGGCAGATACGGG - Intergenic
955930837 3:64055260-64055282 GAACAGTACCTAGCATACAAAGG - Intergenic
957184373 3:76922833-76922855 GAACAATACATGGCTTCTAAGGG - Intronic
958562703 3:95767821-95767843 GAACACTACTTAGCTGATAAAGG + Intergenic
958830361 3:99080310-99080332 GACGACAACTTGGCCTATAATGG + Intergenic
960646484 3:119890288-119890310 GAATACAACTTAGCATAAAAAGG + Intronic
961127155 3:124430021-124430043 TCACAGTACTTTGCATATAATGG - Intronic
962246297 3:133796718-133796740 TAACACTACTGGACATATAGTGG + Intronic
962704861 3:138033151-138033173 GAACACAACTTGTTATTTAATGG - Exonic
963012590 3:140786770-140786792 GAATACTACTCAGCATAAAAAGG + Intergenic
963494286 3:146040910-146040932 GAAAAATACTTGGAAGATAAAGG - Intergenic
964981576 3:162688387-162688409 GAATAGTACCTGGCATATAGTGG + Intergenic
965715272 3:171596096-171596118 GCACAATATTTGGCATATAGTGG - Intergenic
967529755 3:190534811-190534833 GAACACTATTTGGGAAGTAAAGG - Intronic
968318888 3:197748332-197748354 GAACAATATTTGGCATGTCAAGG - Intronic
970872860 4:20836055-20836077 AAACTCTATTTGGCAAATAATGG - Intronic
972608606 4:40636403-40636425 GAACACTGCCTGGAACATAATGG + Intergenic
973667161 4:53173295-53173317 GTACACTTCTTGGCTTATGATGG - Intronic
977455439 4:97254163-97254185 GCACACTAACTGGCATATAAGGG - Intronic
977531601 4:98207102-98207124 GAACATTACTTTGGATAAAATGG + Intergenic
977936744 4:102814672-102814694 AATCACTACCTGGCACATAATGG + Intronic
978835338 4:113142613-113142635 GATCACTACATGGCATATTTGGG + Intronic
981256901 4:142672074-142672096 GAATACTACTTAGCATAAAAAGG - Intronic
981498825 4:145424069-145424091 GAACACTACCAGGGATAAAAAGG - Intergenic
982062587 4:151619705-151619727 GAACAGTGCCTGGCATATATTGG - Intronic
982205226 4:152992738-152992760 GAATAATACTTGGCATGGAAGGG - Intergenic
982383837 4:154779017-154779039 GAAAGATACTTGGCATACAAGGG - Intergenic
982386509 4:154810769-154810791 TAATACCACTTGGAATATAATGG + Intronic
983017829 4:162637371-162637393 GTAGACTACTTGACATTTAATGG + Intergenic
983259059 4:165435283-165435305 GACCATGACTTTGCATATAATGG + Intronic
985096798 4:186420900-186420922 GAACAATACTTAACATATAATGG - Intergenic
990130474 5:52576018-52576040 GAATACTACTCAGCATAAAAGGG - Intergenic
990318207 5:54604023-54604045 GAACAATATTTGGCACATAATGG - Intergenic
991605672 5:68398118-68398140 GAACATTATTTGGCAATTAAAGG + Intergenic
992327284 5:75673283-75673305 GAACAAGACTTGGCTTCTAATGG - Intergenic
995909646 5:117170178-117170200 GAACACTACTTGGAACATGCTGG - Intergenic
997091038 5:130858519-130858541 GAACACAATATTGCATATAATGG + Intergenic
998778665 5:145631651-145631673 GAATAATACCTGGCACATAATGG + Intronic
1000349414 5:160341489-160341511 GAACAGAGCCTGGCATATAAAGG + Intronic
1000937152 5:167316229-167316251 GAACAATGCCTGGCATGTAATGG + Intronic
1001133072 5:169080339-169080361 GCACAGTGCTTGGCACATAAAGG - Intronic
1002302231 5:178263537-178263559 GCACATTCCTTGGCATGTAAAGG - Intronic
1003940302 6:11017856-11017878 GAACAATGCCTGGCACATAATGG + Intronic
1004523896 6:16387856-16387878 GTACACTACCTGGCATGTAGTGG - Intronic
1004788192 6:18992537-18992559 GAACTCCATTTGGCATACAAAGG + Intergenic
1005416635 6:25606723-25606745 GAACAAGACTTGGCAAACAATGG + Intronic
1006923237 6:37639793-37639815 GAACAGTGCCTGGCATATAATGG + Intronic
1007488777 6:42201470-42201492 GAACAGTACTTGGCATGTACAGG + Intergenic
1008629656 6:53351041-53351063 GTACAATCCCTGGCATATAAGGG + Intergenic
1010576120 6:77533025-77533047 GAACAATGCTTGGAATATGAGGG + Intergenic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1013529924 6:111009686-111009708 GAACACGACTTGCCTCATAAAGG - Intronic
1013707590 6:112856806-112856828 GAACAATACTTGGTACATAATGG - Intergenic
1014226402 6:118852985-118853007 GAATACTACTAGCAATATAAAGG - Intronic
1015449612 6:133350197-133350219 GAACACTGCATGGCACATAATGG - Intronic
1016013918 6:139165043-139165065 GCACAGTACCTGGCACATAAAGG - Intronic
1016721934 6:147308488-147308510 GAACAGTACCTGCCATATAGTGG - Intronic
1018722935 6:166587514-166587536 GAACAGTACCTGGCATAGAGTGG + Intronic
1020369184 7:7414162-7414184 AATGGCTACTTGGCATATAAAGG + Intronic
1020373144 7:7456703-7456725 GAACACTTTCTGGCTTATAATGG - Intronic
1023071501 7:36439417-36439439 GCACAGTGATTGGCATATAAAGG - Intronic
1023705242 7:42933721-42933743 GCACATTGCTTGGCATATAGTGG - Intronic
1025965774 7:66269638-66269660 GAATATTACTGGGCATATAATGG - Intronic
1027136372 7:75627219-75627241 GAACAGCACATGGCATATCAAGG + Intronic
1027195566 7:76027782-76027804 GAACAATACCTGGCATATCAAGG + Intronic
1027985317 7:85280614-85280636 GAACATGATTTGGCATTTAAGGG - Intergenic
1028821831 7:95220633-95220655 GTACATTGCTTGGCATATAGTGG - Intronic
1029923413 7:104290432-104290454 GCACAATGCTTGGCACATAATGG - Intergenic
1031147093 7:118008554-118008576 TAACACTTCTTGTCATATCAAGG + Intergenic
1034761481 7:153676176-153676198 GAGCAGTGCCTGGCATATAATGG + Intergenic
1035144192 7:156796932-156796954 GAATAGTGCTTGGCACATAAGGG - Intronic
1037924118 8:22831381-22831403 GTACTCTACTGGGAATATAATGG - Intronic
1039320472 8:36424668-36424690 GAAGAGTGCCTGGCATATAATGG + Intergenic
1041766934 8:61428687-61428709 GACCAATCCCTGGCATATAATGG - Intronic
1041914428 8:63125733-63125755 GGACACTGCCTGGCACATAAGGG + Intergenic
1042379761 8:68100296-68100318 GAACAGTACTTGGCACATAGAGG - Intronic
1043789100 8:84440697-84440719 GAATACTGCTTGGCATAAAAAGG - Intronic
1044243758 8:89917077-89917099 TAACAAAACTTGGGATATAATGG - Intronic
1045371778 8:101531421-101531443 GAACATTAGCTGGCATATAGTGG + Intronic
1045688193 8:104733626-104733648 GAACACCTCTTGGCAGACAATGG + Intronic
1046203741 8:110961150-110961172 GAACATTTCATGGCATATAAGGG - Intergenic
1050058637 9:1681455-1681477 GAACAGTAAATGGCACATAATGG - Intergenic
1050340924 9:4637731-4637753 GAACAACACTTGGGACATAATGG + Intronic
1051125806 9:13804413-13804435 GTAAACTGCTTGGCATTTAATGG - Intergenic
1051763137 9:20490920-20490942 GAAAACTAATTGGCCCATAATGG + Intronic
1052036762 9:23691233-23691255 GAACATCACTTGGCATGTAAGGG + Exonic
1053111481 9:35463994-35464016 GAACGATCCTTGACATATAATGG + Intergenic
1053507814 9:38659620-38659642 CAACACTACTGTGTATATAACGG + Intergenic
1054866905 9:70012228-70012250 GAACACTATTTGACCTAAAAGGG + Intergenic
1055765303 9:79656841-79656863 GAATTTTACTTGGCATCTAAAGG - Intronic
1057456890 9:95221641-95221663 GAACAGTATCTGGAATATAAAGG + Intronic
1058008955 9:99953278-99953300 GCACAATGCTTGGCACATAATGG + Intronic
1058057537 9:100464186-100464208 GATTTATACTTGGCATATAAAGG - Intronic
1059667242 9:116460056-116460078 GAATATTACTTGCCATAAAAAGG + Intronic
1060020525 9:120126536-120126558 GAACACTGCCTGGCATACAATGG - Intergenic
1060443460 9:123664042-123664064 GAAAACTACATGTCATAAAAAGG + Intronic
1185811558 X:3115197-3115219 GTACTCTTCTTGGTATATAAGGG - Intergenic
1185870604 X:3662045-3662067 GAACATTACTTGGCACATAAGGG - Intronic
1186876241 X:13820804-13820826 GAACACTTCTGGGCACATAGCGG + Intronic
1188179041 X:27031210-27031232 GCACAATGCCTGGCATATAATGG - Intergenic
1188602954 X:31991893-31991915 GAACAGTGCTTGGAACATAATGG - Intronic
1189515928 X:41713437-41713459 GTACACCACTTGGCATTTATAGG - Intronic
1189585973 X:42462178-42462200 GAATACTAGTTGGCTTAGAAAGG + Intergenic
1189958063 X:46296773-46296795 GAATACTGCTTGGAATATATTGG - Intergenic
1190711474 X:53073644-53073666 GAACACTACATAGCACATCATGG - Intronic
1196806826 X:119595590-119595612 GAACACTACTTGGGACAAAAAGG + Intronic
1197329012 X:125130784-125130806 GAACACTGGCTGGCAGATAATGG - Intergenic
1197895887 X:131314620-131314642 TAAGACTACTTGGAATATTATGG + Intronic
1200793432 Y:7319085-7319107 GGACATTGCTTGGCACATAAGGG + Intergenic