ID: 917034396

View in Genome Browser
Species Human (GRCh38)
Location 1:170731220-170731242
Sequence TTTTGTCAGTGCAAGAACAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917034396 Original CRISPR TTTTGTCAGTGCAAGAACAA CGG (reversed) Intronic
900535253 1:3173839-3173861 TTCTCTCAGAGGAAGAACAAAGG - Intronic
901517361 1:9757558-9757580 TTTTTTCAGTTCAAGAACAAAGG - Intronic
907539187 1:55196762-55196784 TTTTGTCAGAATAGGAACAAAGG - Intronic
908311851 1:62892037-62892059 TTCTGTCAAGGCAAGAAAAAAGG - Intergenic
908331830 1:63078574-63078596 TTTTGTAGGCCCAAGAACAACGG + Intergenic
909015478 1:70375427-70375449 TTTTGTCAGCACATTAACAATGG + Intronic
910795429 1:91092779-91092801 TTTTGCCTGTGCAAGACTAATGG + Intergenic
912950031 1:114114151-114114173 TTTTGCCAGGGCCAGGACAAGGG + Intronic
913262566 1:117012737-117012759 TTTTGTCAAAGCAAGTATAAAGG + Intronic
915716219 1:157947565-157947587 TTTTGACAGAGAAGGAACAAGGG + Intergenic
916624954 1:166545564-166545586 TTTTTTAAATGAAAGAACAAAGG - Intergenic
917034396 1:170731220-170731242 TTTTGTCAGTGCAAGAACAACGG - Intronic
917259229 1:173148870-173148892 TTCTGTCAGTTGGAGAACAACGG + Intergenic
917402838 1:174670096-174670118 TTTTTTCAGTCCATGAACATGGG + Intronic
918339478 1:183556217-183556239 TTTTATCAGTGAATGAAGAATGG - Exonic
919098908 1:193069542-193069564 TTTTGTAACTGCCAGAGCAAGGG - Exonic
919543952 1:198888664-198888686 CTTTGGCATTGCAAGATCAAAGG - Intergenic
922292967 1:224224204-224224226 CTTTGACAGTGCTAGAACAGAGG + Intergenic
923084730 1:230694767-230694789 TTTGGTCAGTGACAGAACCATGG + Intergenic
924645737 1:245875917-245875939 CTTGCTCTGTGCAAGAACAAGGG + Intronic
1064608569 10:17072355-17072377 TTTTGCCATTGAAAGAAAAAAGG + Intronic
1064817233 10:19279651-19279673 TTGTAGCAGTGGAAGAACAAAGG + Intronic
1065415117 10:25476589-25476611 TTTTGTAAATGCAAGAAGAGAGG + Intronic
1066089601 10:32004505-32004527 CTTTGTCAGTACAAGAGAAAGGG - Intergenic
1066171737 10:32856047-32856069 TTTTGTCTGTGTAAGATAAAGGG - Intronic
1066202715 10:33157682-33157704 TTTTGACAGAGAAAAAACAAAGG - Intergenic
1067960649 10:50844955-50844977 TTTTGTAAGTGTTAGCACAAAGG + Intronic
1068043321 10:51855137-51855159 GTTTGTCAGAGTAAGAAAAATGG + Intronic
1071535288 10:86423834-86423856 TTCTGTCTCTGCAGGAACAATGG - Intergenic
1071915484 10:90290521-90290543 TTTTCTCAGTCCCAGAGCAAGGG - Intergenic
1073142886 10:101260866-101260888 TTGTCTCAGTCCAAGAGCAAAGG - Intergenic
1073507070 10:104005161-104005183 TTTTGTCAGTGAAAAAGCAGAGG + Intronic
1074740063 10:116477921-116477943 TATTGTTATTGCAAGAACAAAGG - Exonic
1074855977 10:117473847-117473869 TTTTGTAAGAGCAAGACAAAAGG - Intergenic
1075201485 10:120408397-120408419 TTTTATCAGTGAAATAAGAAAGG - Intergenic
1078313755 11:10273577-10273599 TTTTGTCAATGCTAGGACCATGG + Intronic
1078562062 11:12380750-12380772 TTGTGTCTGTGCTAGAATAAGGG - Intronic
1078815298 11:14815213-14815235 CTTTGTCAGTGGAAGAATTATGG + Intronic
1079875258 11:25848474-25848496 TTTTTTCTGTGAAAGAACAAGGG - Intergenic
1080316588 11:30956962-30956984 TTTTCTCAGTGAAATAAGAAGGG - Intronic
1080417789 11:32085173-32085195 TTTTATCAGTGCAAGACGCAAGG + Intronic
1083229509 11:61307098-61307120 TTTTGCCTGGCCAAGAACAATGG + Intronic
1083560558 11:63670366-63670388 TTTTGTCAGTCTTAGAATAACGG - Intronic
1085774609 11:79354077-79354099 CTTTGTAAGTGCAAAAACCAAGG - Intronic
1086859120 11:91903705-91903727 TTTTGTCATAGAAAGAACACAGG - Intergenic
1089917528 11:122172895-122172917 ATTTGTCAGAGCCAGATCAAAGG - Intergenic
1096393238 12:51246044-51246066 TTTTACCTGTACAAGAACAAAGG - Exonic
1097424863 12:59431147-59431169 TTTTGTCATTGTAAGCATAAGGG - Intergenic
1097810202 12:64010777-64010799 TTTTGTCAGTGGAAAAACTGAGG + Intronic
1098010578 12:66046460-66046482 TTTTGTCTCTGCAAGAATATTGG + Intergenic
1098194136 12:67981859-67981881 TTTTCAGAGTGCAACAACAAAGG - Intergenic
1098496523 12:71142078-71142100 TTTTGTTAGTGAAAAAACAGAGG - Intronic
1099073833 12:78080517-78080539 TTCTGTCATTACAACAACAATGG - Intronic
1099828259 12:87807020-87807042 TTAGTCCAGTGCAAGAACAAGGG + Intergenic
1099997105 12:89790040-89790062 TGCTGTCAGTGGAAGAACACAGG + Intergenic
1100002062 12:89849170-89849192 TGTTCTCACTGCAAGAAAAAAGG + Intergenic
1100267127 12:92988181-92988203 ATTTGTCACAGCAAGGACAAGGG + Intergenic
1100330457 12:93576972-93576994 TGTTGTCAGTGGGAGAAAAACGG - Intronic
1100742900 12:97614819-97614841 TTTTGTCTGTGCAAAAAAGAAGG - Intergenic
1103126427 12:118426738-118426760 AATTGTAAATGCAAGAACAAAGG - Intergenic
1103130122 12:118460811-118460833 TTTTGTCATAGCAACAAAAATGG + Intergenic
1104075487 12:125385846-125385868 TCTAGTCAGTGCAAAAGCAATGG - Intronic
1106430872 13:29679296-29679318 TTTGGTGAGTTCAAGAACAATGG - Intergenic
1106695844 13:32171712-32171734 TTATGCCAGTGGAAGAACTAAGG - Intronic
1108162089 13:47651437-47651459 TTTTGTCAGTGGAAGAATGTTGG - Intergenic
1108511250 13:51157839-51157861 TTTTGTGAGAGCCAGAACACAGG - Intergenic
1109777613 13:67062645-67062667 TTTTGCAAGTTCAAGAGCAAAGG - Intronic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1111161505 13:84400136-84400158 TCTTCTGAGTGCAAGAAGAAAGG + Intergenic
1113421295 13:110173579-110173601 TTTTGTCATAGCAACCACAAGGG + Intronic
1115883874 14:37949840-37949862 TTTTGTCTCTGCCAGAAAAAGGG - Intronic
1120386360 14:83851471-83851493 TTTTTTCAGTGCAGCAAAAATGG - Intergenic
1121746698 14:96301248-96301270 TTTTATCAGTGAAGGAACTAAGG + Intronic
1124039434 15:26086828-26086850 GTTTGTTAGAGCAAGAATAAGGG - Intergenic
1127464885 15:59234367-59234389 TTCTGTCAGGGAGAGAACAAAGG - Intronic
1129175699 15:73838286-73838308 CTTTGTCTGTGCCAGAACCATGG + Intergenic
1133425264 16:5682997-5683019 TTCTGTAAGTGAATGAACAAAGG - Intergenic
1134059938 16:11193162-11193184 TTTTGTTTGTGGAATAACAAAGG - Intergenic
1135233627 16:20734249-20734271 TTTTGATAGTGCAAGACAAAAGG - Exonic
1136647004 16:31629687-31629709 TTTTTCCAGTCCATGAACAAGGG - Intergenic
1136658221 16:31726897-31726919 TTTTTCCAGTCCATGAACAAGGG + Intronic
1138938297 16:61758085-61758107 TGTTGTTAGTGAAAGAGCAAAGG + Intronic
1139290118 16:65850048-65850070 TTTTGTAAGTGGGAGAAGAAAGG - Intergenic
1143992751 17:10980503-10980525 TTTTGTTAGAGCAACAAAAATGG - Intergenic
1144238671 17:13287891-13287913 TCTTGTGACTGCCAGAACAATGG + Intergenic
1145819264 17:27818742-27818764 TTCTGTCAGTGAAAGAGAAAGGG - Intronic
1146131632 17:30282014-30282036 ATTTGTCAGTGCCACAAAAAGGG - Intronic
1150635428 17:66909878-66909900 TTTTGACAGTGAAAGGGCAAAGG - Intergenic
1151002617 17:70395821-70395843 TTTACTGAGTGAAAGAACAAAGG + Intergenic
1153917008 18:9754879-9754901 TTTAGTGAGTGGAAGAATAAAGG + Intronic
1155541985 18:26878336-26878358 TATTATCAGTGCAAAAGCAATGG - Intergenic
1156648482 18:39196712-39196734 TTTTGTGAGTCAAAGAAAAAAGG - Intergenic
1156708873 18:39917365-39917387 ATTTGGCAGTACAATAACAAAGG + Intergenic
1159289651 18:66399289-66399311 CTTTGTCAGTATAAAAACAAAGG - Intergenic
1159690767 18:71484188-71484210 TTTTGTCCATGAAAGTACAAAGG - Intergenic
1159974212 18:74690606-74690628 TTTTGGCAGTTGAAGAAAAATGG + Intronic
1162457437 19:10794067-10794089 TTTTGTCAGAGGAAAAACACAGG - Intronic
1164608034 19:29613856-29613878 TTTTGTCACTGCAAAGAAAAAGG - Exonic
1168360090 19:55732280-55732302 TTTTGACAGTGGAAAACCAAAGG + Exonic
924993206 2:333323-333345 TTTAGTCAGTGCAATCACACAGG + Intergenic
925995149 2:9286554-9286576 TGTTTTCAGTGCCACAACAATGG - Intronic
927244683 2:20948074-20948096 TTTTGCCTTTGTAAGAACAATGG + Intergenic
928708683 2:33980103-33980125 TTTTGTCAGTGAAGGAAACATGG - Intergenic
929095524 2:38259977-38259999 TTTTGTGTTTGCCAGAACAATGG - Intergenic
929549317 2:42879478-42879500 TTTTGCCAGTGCAATAACCAGGG - Intergenic
930887184 2:56339398-56339420 TTATGTCAGTTCAGGAAAAAAGG - Intronic
931960043 2:67472265-67472287 TCTTGTAATTGCAAGGACAATGG + Intergenic
932701348 2:73994101-73994123 TTTAATCAGGGCAAGTACAAAGG + Intronic
936799211 2:116245931-116245953 TTTTGTCAGGGATGGAACAAAGG + Intergenic
937099328 2:119256638-119256660 TTTTGCCACTGCAAGAGCAGGGG + Intronic
937534255 2:122866729-122866751 TTTAGTCAGTTGAAGAAGAAGGG + Intergenic
938309999 2:130283652-130283674 TTTATTCAGTGCAGGCACAATGG - Intergenic
938444920 2:131368718-131368740 TTTATTCAGTGCAGGCACAATGG + Intergenic
938740640 2:134228521-134228543 TTTTCACAGAGCAAGAAAAAGGG - Intronic
939997667 2:148935190-148935212 CTTTGTCAGGGCAAGAACCAAGG - Intronic
940359811 2:152785554-152785576 TTTTGTTATCTCAAGAACAAGGG - Intergenic
940497341 2:154449158-154449180 TTTTGAAAGAGCAACAACAAAGG + Intronic
940780924 2:157932935-157932957 TTTTCTCAGTCAGAGAACAAAGG + Intronic
941955522 2:171200352-171200374 TTTGGTCTGTGCAACAACAATGG + Intronic
942224932 2:173806642-173806664 TCATGTCAGAGCAAGAATAAAGG + Intergenic
942626046 2:177901912-177901934 ATTTGTCAGTGCAAGACTCAAGG - Intronic
943168322 2:184361868-184361890 TTTTCAAAGTGCCAGAACAATGG - Intergenic
943515938 2:188886828-188886850 TTTTGTCAGAGGTAGAAGAAGGG + Intergenic
943814360 2:192233175-192233197 TTTTGTCAAGGCAAGAACCAAGG - Intergenic
945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG + Intergenic
945427033 2:209719052-209719074 TTTTCATAATGCAAGAACAAAGG + Intronic
1169593491 20:7171724-7171746 TTTTCTGAGTGCCAGGACAAGGG - Intergenic
1169771252 20:9203524-9203546 TTATGTCAGTGCAGAAATAAAGG + Intronic
1170512263 20:17090284-17090306 CTTTGTTAGTGCACAAACAAAGG - Intergenic
1171021339 20:21586890-21586912 TTTAGACAGTGCATGAAGAAGGG - Intergenic
1171062516 20:21979859-21979881 TTTCTTAATTGCAAGAACAAAGG - Intergenic
1172817794 20:37702724-37702746 TTTTGTAAGTGTGAGAAGAATGG - Intronic
1173921681 20:46750874-46750896 TTTTAGCAGTGCGAGAACGAAGG - Intergenic
1176886360 21:14260063-14260085 TTTTGGTATTGAAAGAACAAAGG + Intergenic
1177434695 21:21036260-21036282 TTTTGTCTGTCAAAGAGCAAAGG - Intronic
1177522677 21:22248753-22248775 ATTTGTCAGTGCTATGACAATGG - Intergenic
1178065327 21:28898502-28898524 TTTTGATAGTGCAAGACAAAAGG - Intergenic
1178382171 21:32119790-32119812 TTTTGTCTGTCAAAGCACAAAGG - Intergenic
1180781639 22:18523479-18523501 GTTTGTCAGAGCAAGACCCAAGG + Intergenic
1181238523 22:21462822-21462844 GTTTGTCAGAGCAAGACCCAAGG + Intergenic
1182379458 22:29875028-29875050 TTCTTTCAGTCCAAAAACAAGGG + Intergenic
949733467 3:7142967-7142989 TTTTCTAAGTTCAAGAAAAAAGG + Intronic
952153572 3:30619309-30619331 TATTGACAGAGAAAGAACAAAGG - Intronic
953438126 3:42896123-42896145 TTGTTTCTGTGAAAGAACAAAGG + Intronic
954780075 3:53052186-53052208 TGTTGTCAGGGAAAAAACAATGG + Intronic
954958793 3:54546468-54546490 TTTTATCAATGGAAGAAGAAAGG - Intronic
955531799 3:59880733-59880755 TTTTATAAGAGCAAGAACAGAGG + Intronic
957235662 3:77586499-77586521 TTTTTTGTCTGCAAGAACAATGG + Intronic
957469585 3:80640929-80640951 TACTGACAGTTCAAGAACAAAGG + Intergenic
957858317 3:85908359-85908381 TTTTGTCTTAGCAAGAACTAAGG - Intronic
958878523 3:99642685-99642707 TTTTTCCAGGGAAAGAACAAAGG - Intronic
960292338 3:115900740-115900762 TGTTGACAGTGAAAGAACAATGG + Intronic
960742704 3:120852430-120852452 TTTTGACAGTTCAAAAGCAAAGG + Intergenic
961855916 3:129870892-129870914 ATCTGACAGTCCAAGAACAAAGG + Intronic
963578241 3:147090978-147091000 TTTTGTCAGGGCTATAACATTGG + Intergenic
964337034 3:155666083-155666105 TTTTGTAATAGCAAGAAAAAGGG - Intronic
964519819 3:157552847-157552869 CTTTCTCAGTGTCAGAACAAGGG - Intronic
964528334 3:157639911-157639933 TTTGGTCTGTGCAGTAACAATGG + Intronic
966985880 3:185179931-185179953 TTTTCTCAGTGAAAGAAGCAAGG + Intergenic
967383735 3:188889226-188889248 TTTTGTCAGTGATGGAACTATGG - Exonic
969328069 4:6455451-6455473 TTTGGTCAATGCAAGACCACAGG - Intronic
969831038 4:9797180-9797202 TGTGGTCACTGCAAGGACAAAGG + Intronic
969857122 4:10009051-10009073 TTGTGTCACTGCAGAAACAACGG - Intronic
971514994 4:27474546-27474568 TCTTTTCAGTGAAAGAACAATGG + Intergenic
971829156 4:31667833-31667855 TAGGGTCATTGCAAGAACAATGG - Intergenic
972046131 4:34666661-34666683 CTTTTTCAGTGCATGAAAAATGG + Intergenic
975279999 4:72550833-72550855 TTTTGTCAGTACACATACAAGGG - Intronic
975990575 4:80256057-80256079 TTTGGTGTGTGTAAGAACAAGGG + Intergenic
976292691 4:83437127-83437149 TTTTGTCACTAAAAGATCAAGGG - Intronic
976775510 4:88701711-88701733 TTTTGTCTGTGTAAGAAAGAAGG - Intronic
978016379 4:103751713-103751735 GTTTTTCAGGGAAAGAACAAAGG + Intergenic
978125891 4:105134978-105135000 TTTTGCCAGTGTAAGAAACATGG + Intergenic
978415722 4:108474030-108474052 TTCTGTCAGGGACAGAACAAAGG - Intergenic
980532183 4:134070489-134070511 GGTTGTCAGTGCAACAGCAATGG + Intergenic
981323501 4:143420045-143420067 TCAAGTCAGTGGAAGAACAAAGG - Intronic
984000157 4:174230861-174230883 GTTTGTCAGTGCAACAACCTGGG - Intergenic
984574504 4:181432038-181432060 TTCTATCAGTGCAAAAACATGGG - Intergenic
986080709 5:4390059-4390081 TTTTTTCAGTCCATGAACAAAGG + Intergenic
988448604 5:31316299-31316321 TTTTGTCTGTGAAAAAGCAAAGG + Exonic
990340680 5:54819761-54819783 TTTTGCCACTGCAACAATAATGG - Intergenic
990661724 5:58022913-58022935 CTTTGTCAGTTCTAGGACAAAGG + Intergenic
990752248 5:59029540-59029562 TTCTTTCAGTGCATGAACATGGG - Intronic
992592109 5:78306330-78306352 TTTTCTAAGTGCAATAAGAAGGG + Intergenic
993453108 5:88096662-88096684 TTTTGGAAGTGCTAAAACAAAGG - Intergenic
993592464 5:89810993-89811015 TTTTGTCAGTGTTATAGCAAGGG + Intergenic
994014504 5:94949231-94949253 TAGTGTCAGTGAAATAACAATGG + Intronic
994901307 5:105773795-105773817 TATTTTCAGTGCCAGAGCAAGGG - Intergenic
994961207 5:106604938-106604960 TGTTGTCATTTCAACAACAACGG - Intergenic
995232809 5:109789090-109789112 CTTTGCTAATGCAAGAACAATGG - Intronic
996973601 5:129403181-129403203 TTTGTTCAGTGAAAGAACTAAGG + Intergenic
999360686 5:150984110-150984132 TAATTTCAGTGGAAGAACAAAGG - Intergenic
1000113124 5:158128011-158128033 TTTTTTCAGTAAAAGAAGAAAGG - Intergenic
1003966951 6:11261777-11261799 TTTTAGCAGAGCAAAAACAAGGG - Intronic
1004648219 6:17583388-17583410 TTTTTTGAGTGCAAGAAGAAGGG + Intergenic
1004885349 6:20045959-20045981 TAATGTCATTACAAGAACAAGGG + Intergenic
1005145041 6:22679880-22679902 TTTTGCCAATGAAAGAACCAGGG + Intergenic
1005871598 6:29977714-29977736 TCTCGTGGGTGCAAGAACAAGGG + Intergenic
1009357898 6:62774882-62774904 TTTTGTGAGTGACAGAAAAAAGG + Intergenic
1009429221 6:63547859-63547881 GTTGGAAAGTGCAAGAACAAAGG - Intronic
1009931632 6:70183004-70183026 GTTTGTTAGTGAAAGAAGAATGG + Intronic
1011237861 6:85237647-85237669 TTATGACACTGCCAGAACAATGG - Intergenic
1011656455 6:89556223-89556245 TTGTGTCAGTGTTAGAAGAAAGG - Intronic
1011968498 6:93191372-93191394 TTTTGACACAGCAACAACAAAGG + Intergenic
1013314464 6:108928043-108928065 TTTTTTCAGTTCAAAAAAAATGG + Intronic
1013961136 6:115901850-115901872 CTCTGTAAGTGAAAGAACAAAGG + Intergenic
1014212280 6:118719661-118719683 TTTCTTGAGTGAAAGAACAAAGG - Intergenic
1014471299 6:121818091-121818113 TTTTTTCAGTGGAAGAGGAAAGG + Intergenic
1014687966 6:124527253-124527275 TTTTGCCAGAGTAAGCACAAAGG - Intronic
1015316377 6:131821493-131821515 TTCTGTATGTGCAAGAGCAATGG - Intronic
1015756824 6:136615842-136615864 ATTTGTCAGTGTAAGATCTAAGG - Intronic
1016017483 6:139200818-139200840 TTTTGTCACTGCAGTTACAAGGG - Intergenic
1016929560 6:149390591-149390613 TTTTGTTAGCTCACGAACAATGG - Intronic
1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG + Intergenic
1018485059 6:164232643-164232665 TTTCCTCATTGCAAGAATAAAGG - Intergenic
1018648810 6:165973477-165973499 TTTTGTGAGTGAAAGATAAAAGG + Intronic
1018703619 6:166447522-166447544 TTTTCCCAGTGCAAGAAACACGG + Intronic
1020675613 7:11181551-11181573 ATGTGTCAGTGAAAGAAGAAGGG - Intergenic
1020745750 7:12076005-12076027 TGATGACAGTGCAAGAACAGAGG + Intergenic
1024585504 7:50838488-50838510 TTTTGTCAGTGAGAGAAAAATGG + Intergenic
1027677938 7:81182207-81182229 CTTAGCCAGTGCAGGAACAATGG + Intronic
1030595531 7:111534228-111534250 TTTTTTCACTGCAATAAAAATGG - Intronic
1032595633 7:133236783-133236805 TTGTGCCAGAGCAAGAACAGAGG - Intergenic
1034483729 7:151343195-151343217 GTTTGTCAGTGCTTGAAAAATGG + Intronic
1035870846 8:3134638-3134660 TTTAGTCAGTGCACTAACAGGGG - Intronic
1036036773 8:5028636-5028658 TGTTGACAGTGCAAGCACCATGG + Intergenic
1037383331 8:18311716-18311738 CTTTGTGAGTTCAAGAACGAAGG + Intergenic
1038581404 8:28752090-28752112 TTTGGTATGTGCTAGAACAATGG + Exonic
1038628800 8:29220646-29220668 TTCTGTCAGTGCTAGACCAAAGG - Intronic
1038764226 8:30412533-30412555 TTTTGAGAGGGCAAGAACCATGG - Intronic
1039779812 8:40773154-40773176 ATTTGTCAGGGGAAGAACATTGG + Intronic
1040516427 8:48139037-48139059 AAATGTCAGTGAAAGAACAAAGG + Intergenic
1041202968 8:55469280-55469302 TTTTGTTAGATTAAGAACAATGG + Intronic
1041537770 8:58946418-58946440 TTTTGTCTCTGCATGAACAAGGG + Intronic
1042821343 8:72933503-72933525 GATTGTCAGTACAAGAAGAATGG + Intronic
1043124771 8:76376884-76376906 TTTTTTTAGAGAAAGAACAAAGG - Intergenic
1044239793 8:89875486-89875508 CCTTGGCAGTGCAAGAACCATGG + Intergenic
1045036933 8:98183249-98183271 TTTTTTCGGTCCAAAAACAATGG - Intergenic
1045155569 8:99466084-99466106 TTTCTTCAGTGAAAAAACAAGGG + Intronic
1047780825 8:128109546-128109568 TTTTGTGAGAGTAAGAACAATGG + Intergenic
1050241976 9:3646164-3646186 TTTTGTAAATGCAATAACTAGGG - Intergenic
1052240036 9:26260747-26260769 TTTTTTCAAAGCAAGTACAAAGG - Intergenic
1187049458 X:15681151-15681173 TTTTGTAAGTACAAGTACAGAGG - Intergenic
1187251744 X:17605063-17605085 TTATGTCAGTGTAAGAGCAGAGG - Intronic
1187508795 X:19899110-19899132 TTTTCTCAGTGCCTGAATAAAGG + Intergenic
1187592355 X:20732257-20732279 TTTTGTAAATGCCACAACAAAGG + Intergenic
1188041410 X:25373890-25373912 TATTGTAAGTGGAAGAAAAAAGG - Intergenic
1188097967 X:26045955-26045977 TTGTGTCAGTGTATAAACAAGGG + Intergenic
1189073938 X:37896034-37896056 TTTTGTCTGTGCAATTACTAGGG + Intronic
1189693052 X:43636813-43636835 TTTTGTATGTACATGAACAAAGG - Intergenic
1190390404 X:49925431-49925453 TTTTGTCCCTGCAAAGACAAAGG - Intronic
1190914183 X:54798145-54798167 GTATGTCAGTTCAAGAAGAATGG + Exonic
1191967195 X:66772003-66772025 TTATTTCAATCCAAGAACAATGG + Intergenic
1193276126 X:79590211-79590233 TTTTGCCAGTGCACGCACATGGG - Intergenic
1193691755 X:84654352-84654374 TCTTGTCAGTGACAGATCAATGG + Intergenic
1195726254 X:107920042-107920064 TTTTGTTAGAACAAGGACAAGGG + Intronic
1195990764 X:110679887-110679909 TTCAGTGAGTTCAAGAACAAGGG - Intronic
1196881574 X:120203202-120203224 GTTTCTCAGTGAAAGAACAGTGG + Intergenic
1197169603 X:123416702-123416724 TTTTGCCTGGGCAATAACAAGGG - Intronic
1197639596 X:128953379-128953401 TTTTGCAAGTGTAAGAAAAATGG - Intergenic
1198947907 X:142035415-142035437 TTTTTTCAGTCCAAGAACATGGG + Intergenic
1201362300 Y:13166136-13166158 TTTGGTCTCTGAAAGAACAAAGG - Intergenic
1201636844 Y:16132804-16132826 TTTTTTCACAGCAAGAATAATGG + Intergenic