ID: 917035883

View in Genome Browser
Species Human (GRCh38)
Location 1:170746412-170746434
Sequence CTGCTGTCCTTGCTCCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917035883_917035892 -5 Left 917035883 1:170746412-170746434 CCCGTGGGGAGCAAGGACAGCAG No data
Right 917035892 1:170746430-170746452 AGCAGGAAGGGATTGGGAAGGGG No data
917035883_917035891 -6 Left 917035883 1:170746412-170746434 CCCGTGGGGAGCAAGGACAGCAG No data
Right 917035891 1:170746429-170746451 CAGCAGGAAGGGATTGGGAAGGG No data
917035883_917035893 -1 Left 917035883 1:170746412-170746434 CCCGTGGGGAGCAAGGACAGCAG No data
Right 917035893 1:170746434-170746456 GGAAGGGATTGGGAAGGGGCTGG No data
917035883_917035890 -7 Left 917035883 1:170746412-170746434 CCCGTGGGGAGCAAGGACAGCAG No data
Right 917035890 1:170746428-170746450 ACAGCAGGAAGGGATTGGGAAGG No data
917035883_917035895 1 Left 917035883 1:170746412-170746434 CCCGTGGGGAGCAAGGACAGCAG No data
Right 917035895 1:170746436-170746458 AAGGGATTGGGAAGGGGCTGGGG No data
917035883_917035894 0 Left 917035883 1:170746412-170746434 CCCGTGGGGAGCAAGGACAGCAG No data
Right 917035894 1:170746435-170746457 GAAGGGATTGGGAAGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917035883 Original CRISPR CTGCTGTCCTTGCTCCCCAC GGG (reversed) Intergenic
No off target data available for this crispr