ID: 917039537

View in Genome Browser
Species Human (GRCh38)
Location 1:170789187-170789209
Sequence TAACCATGGTTTTCTGTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917039532_917039537 30 Left 917039532 1:170789134-170789156 CCTATCTCAGGAGTCTGCAGCCT No data
Right 917039537 1:170789187-170789209 TAACCATGGTTTTCTGTTACGGG No data
917039534_917039537 10 Left 917039534 1:170789154-170789176 CCTATGGATTAAGCAAGATCATG No data
Right 917039537 1:170789187-170789209 TAACCATGGTTTTCTGTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917039537 Original CRISPR TAACCATGGTTTTCTGTTAC GGG Intergenic
No off target data available for this crispr