ID: 917041259

View in Genome Browser
Species Human (GRCh38)
Location 1:170808652-170808674
Sequence AAGCCACTCCTGCTGCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917041259_917041265 14 Left 917041259 1:170808652-170808674 CCAGTTTGCAGCAGGAGTGGCTT No data
Right 917041265 1:170808689-170808711 CCTTGCTAGAGAAGCTCAGAGGG No data
917041259_917041263 13 Left 917041259 1:170808652-170808674 CCAGTTTGCAGCAGGAGTGGCTT No data
Right 917041263 1:170808688-170808710 GCCTTGCTAGAGAAGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917041259 Original CRISPR AAGCCACTCCTGCTGCAAAC TGG (reversed) Intergenic
No off target data available for this crispr