ID: 917050836

View in Genome Browser
Species Human (GRCh38)
Location 1:170920683-170920705
Sequence GAAAACTATCCCTTTTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917050829_917050836 21 Left 917050829 1:170920639-170920661 CCCAACAGGGACCAGTCTCAGCT No data
Right 917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG No data
917050830_917050836 20 Left 917050830 1:170920640-170920662 CCAACAGGGACCAGTCTCAGCTC No data
Right 917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG No data
917050832_917050836 -2 Left 917050832 1:170920662-170920684 CCAGCCCTCCTGCTGCAGTCAGA No data
Right 917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG No data
917050831_917050836 10 Left 917050831 1:170920650-170920672 CCAGTCTCAGCTCCAGCCCTCCT No data
Right 917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG No data
917050835_917050836 -10 Left 917050835 1:170920670-170920692 CCTGCTGCAGTCAGAAAACTATC No data
Right 917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG No data
917050833_917050836 -6 Left 917050833 1:170920666-170920688 CCCTCCTGCTGCAGTCAGAAAAC No data
Right 917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG No data
917050834_917050836 -7 Left 917050834 1:170920667-170920689 CCTCCTGCTGCAGTCAGAAAACT No data
Right 917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917050836 Original CRISPR GAAAACTATCCCTTTTATGC AGG Intergenic
No off target data available for this crispr