ID: 917060973

View in Genome Browser
Species Human (GRCh38)
Location 1:171038988-171039010
Sequence GCTGATGGTCAGCTACATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917060973 Original CRISPR GCTGATGGTCAGCTACATCC GGG (reversed) Intronic
900504334 1:3021782-3021804 GCACATGGTCAGCTCCATCGTGG + Exonic
900659832 1:3776862-3776884 GCTGAGGTCCAGCCACATCCGGG - Intergenic
902334015 1:15744558-15744580 GCTGCTGGTCATCTACATGCAGG + Exonic
903279701 1:22243633-22243655 GCTGATGGTCGGGGACACCCTGG - Intergenic
905322096 1:37125109-37125131 ACTGATGGCAGGCTACATCCAGG - Intergenic
907409870 1:54276310-54276332 CAAGATGGTCAGCTACTTCCTGG + Intronic
909804644 1:79858998-79859020 GCTGTTGGACAGCCAAATCCTGG - Intergenic
909897540 1:81091616-81091638 GATGATGGCCAGCTACACCTGGG - Intergenic
911912329 1:103652442-103652464 GCAGAAGGTCATCTACATACTGG + Intergenic
911916125 1:103699506-103699528 GCAGAAGGTCATCTACATACTGG - Intronic
911919744 1:103746580-103746602 GCAGAAGGTCATCTACATACTGG + Intronic
914843393 1:151266320-151266342 GCTGATGGTCATCTTCAGCAGGG - Exonic
917060973 1:171038988-171039010 GCTGATGGTCAGCTACATCCGGG - Intronic
919639147 1:200032453-200032475 GCTCATGGTCATCTGCATTCAGG - Intronic
919850202 1:201667368-201667390 GCTGATGGTCTCCTACAGACAGG + Intronic
1069618628 10:69822417-69822439 CCTGGTGGGCAGTTACATCCTGG - Exonic
1071475500 10:86021896-86021918 GCTGAGGGTGAGCTGCAGCCTGG + Intronic
1072290307 10:93959144-93959166 GCTGATGGTCATCTTCAGCAGGG + Intergenic
1073453252 10:103621876-103621898 GCTGAGGGTCAGGTCCAGCCAGG - Intronic
1074662296 10:115674525-115674547 ACTGCATGTCAGCTACATCCTGG + Intronic
1076130061 10:128008039-128008061 GCTGGTAGTCAGCTTCCTCCAGG + Intronic
1076166289 10:128285182-128285204 GCTGAGTATCAGCTACTTCCAGG + Intergenic
1079263802 11:18910742-18910764 GCAGATGGTCATGTACAGCCTGG + Intergenic
1082761510 11:57131282-57131304 GCTCATGGTCAGCCTCAGCCTGG + Intergenic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1085391035 11:76182330-76182352 CCTGATGGGCAGCTCCTTCCTGG + Intergenic
1087224554 11:95583406-95583428 GTTGATGGGTAGCTACATTCTGG + Intergenic
1091842843 12:3633149-3633171 CCTGAGGGCCTGCTACATCCTGG - Intronic
1096111979 12:49034282-49034304 GCCGCTGGTCAGCTTCATCTGGG + Exonic
1101946298 12:109139885-109139907 GCTGATGACCAACTTCATCCTGG + Exonic
1104868346 12:131975177-131975199 GCTGAGTGTCAGCCACAGCCGGG + Intronic
1106224111 13:27772401-27772423 GCAGAAGACCAGCTACATCCTGG + Intergenic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1108378357 13:49834368-49834390 GTTTATGGTCAGGTACATACAGG + Intergenic
1116094889 14:40354513-40354535 GCCTATGGTCAGGTACACCCAGG - Intergenic
1121410869 14:93747280-93747302 GCTGATGGTCAAGTACAGCGAGG + Intronic
1122512392 14:102280122-102280144 CCTGGTGGTGAGGTACATCCTGG + Intronic
1125687699 15:41573169-41573191 GCTGATGGTCGGCTCCTGCCTGG + Intronic
1125725282 15:41865290-41865312 GCTGATTATCTGCCACATCCAGG + Intronic
1125725661 15:41866970-41866992 GCTGATGGCCAGCTTCACCCAGG - Exonic
1126551531 15:49936219-49936241 TCTGCTGCTCAGCTGCATCCTGG + Intronic
1129454932 15:75671694-75671716 GGGCATGTTCAGCTACATCCTGG - Intergenic
1132897536 16:2236198-2236220 GTAGACGGTCAGCCACATCCCGG - Exonic
1132978832 16:2724472-2724494 GCTGATGGTGAGGGACATTCTGG + Intergenic
1135827275 16:25740092-25740114 GATGATCGTCATCTGCATCCAGG + Intronic
1140881421 16:79201229-79201251 GCTGATTCTCAGCTCCCTCCAGG + Intronic
1141261934 16:82462269-82462291 ACTGAGGGTCAGCAACATCAGGG + Intergenic
1150313718 17:64150718-64150740 TCTGATGGTGACCTTCATCCCGG - Intronic
1153562384 18:6384073-6384095 GGTGATGTTCAACTACATCTGGG + Intronic
1154376896 18:13818289-13818311 GCAGGTGGTCAGCAACAACCAGG + Intergenic
1156294104 18:35774378-35774400 TCTGATGGTCACTTAAATCCAGG + Intergenic
1158727812 18:59990476-59990498 GCTGAGGATCAGCTACATTATGG + Intergenic
1160667198 19:336478-336500 GCTGTTGTTGAGCTTCATCCAGG - Intronic
1164972348 19:32543305-32543327 GGTGATGGTCAGCTTCCTCATGG - Intergenic
1165471398 19:36006749-36006771 CCAGCTGGTCAGCTACAGCCTGG - Exonic
1165472006 19:36009335-36009357 GCGGATGGTCAGCGAGACCCGGG + Exonic
925334075 2:3080338-3080360 GCTGTTGGTCAGCCCCAACCTGG + Intergenic
930075131 2:47400396-47400418 GCTGATTGTCAGGAACATCCAGG + Intergenic
934936392 2:98469027-98469049 GGTGATGGTAAGGTACAGCCAGG - Intronic
938252702 2:129827889-129827911 GCTGAGGGTCTGCTGCCTCCAGG + Intergenic
942240099 2:173954896-173954918 GCTGGTATACAGCTACATCCAGG - Exonic
945929395 2:215840016-215840038 GCTGATGGGCAGCCACAACTTGG - Intergenic
1174395116 20:50242593-50242615 GGTGAGGGTCATCTGCATCCAGG + Intergenic
1177173173 21:17676147-17676169 CCTGATAGTCAGTTACATCTGGG + Intergenic
1181852152 22:25757270-25757292 ACTGAAGGGCAGCTACTTCCAGG + Intronic
1183356194 22:37361063-37361085 GCTAAGGGACAGCCACATCCCGG + Intergenic
949357114 3:3192761-3192783 GGTGCTGGTCAGCTACAGCCAGG - Intergenic
950468046 3:13167134-13167156 GCAGATGGTCAGGAGCATCCTGG + Intergenic
952306408 3:32150694-32150716 TCTGTTGGCCAGCTACAGCCTGG - Intronic
953384211 3:42497081-42497103 GCCGAAGGTCAGCTACACACAGG + Intronic
953480837 3:43250621-43250643 ACTTAGGGTCAGCTATATCCTGG - Intergenic
958158599 3:89787709-89787731 GCTGCTGCTCAGCTCCAGCCTGG + Intergenic
960188384 3:114672528-114672550 GATGATGGTCTTCTCCATCCAGG + Intronic
961993780 3:131219469-131219491 CCTGATGGTTTGCTACACCCAGG - Intronic
962252016 3:133841321-133841343 CCTGATCCCCAGCTACATCCGGG - Exonic
966690957 3:182740918-182740940 GCTGATGGACAGGAACATCAGGG - Intergenic
968910019 4:3472882-3472904 GCTGAAGCTCAGCCACAACCTGG + Intronic
969344372 4:6562119-6562141 GCTCATGCTCAGCTCCCTCCAGG - Intronic
969612173 4:8233492-8233514 GCTGGTGGACCTCTACATCCAGG + Exonic
970906964 4:21227125-21227147 GCTAAAGGTCTGCTACATGCTGG - Intronic
985110340 4:186541368-186541390 GCTAATGGTCAGCTAGACCAGGG + Intronic
993185935 5:84619548-84619570 GCTGGAGGTCAGCTCCATCCAGG - Intergenic
994033799 5:95175792-95175814 GCTGGAGGCCAGCAACATCCTGG - Intronic
997165755 5:131659136-131659158 GTGGATGGGCAGCTCCATCCTGG - Intronic
998741650 5:145209995-145210017 GCTGATGTTCAGCTCCCACCTGG + Intergenic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1005754869 6:28917203-28917225 GCAGATGGTCAGTCTCATCCAGG - Intronic
1011389836 6:86839461-86839483 CCAGATGGTCAGCTACAACATGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1021767476 7:23964320-23964342 GCAGATGGTCAACTTCCTCCTGG + Intergenic
1022330951 7:29378446-29378468 GGCGTTGGTCAGCTATATCCTGG + Intronic
1026792602 7:73344378-73344400 GCTGATGGTAAGATAAATGCTGG - Intronic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1032001482 7:128268193-128268215 GCTGATGGAGAGTTACTTCCAGG + Intergenic
1035744632 8:1952751-1952773 GCTGATGGTCGGCACCAGCCTGG + Exonic
1036432435 8:8702857-8702879 GGTGCAGGTCAGCTACAGCCTGG + Exonic
1036829619 8:12011794-12011816 GCTGTTGGTCAGATACACCCTGG + Intergenic
1037103270 8:15074141-15074163 GCTGATGGTCACAGACATCTGGG - Intronic
1039103765 8:33968225-33968247 ACTGGTGGTCAGCTTTATCCAGG + Intergenic
1041225379 8:55692408-55692430 TCTGAGGGTCACCTAAATCCTGG + Intergenic
1041357536 8:57015925-57015947 GTGGATGGGCAGCTACATCTTGG - Intergenic
1050547215 9:6719101-6719123 GCTGAGGCTCAGCTTCTTCCTGG + Intergenic
1058304813 9:103426533-103426555 GCTCATGGCAAGCTACATCTTGG - Intergenic
1059431813 9:114254977-114254999 GGTGACGGTCACCTATATCCAGG - Intronic
1060211943 9:121715987-121716009 TATGATGCTCAGCTACAACCAGG - Intronic
1061668742 9:132175854-132175876 GCTGATTGCCAGGTACATTCTGG + Intronic
1193312631 X:80025707-80025729 GCTGATGATCTGCCGCATCCAGG - Exonic