ID: 917062939

View in Genome Browser
Species Human (GRCh38)
Location 1:171059893-171059915
Sequence AGGGGAAGAAACTTAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1132
Summary {0: 3, 1: 28, 2: 199, 3: 281, 4: 621}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917062934_917062939 -2 Left 917062934 1:171059872-171059894 CCTGTCTGGGAGTGGGAGGTGAG 0: 1
1: 0
2: 6
3: 84
4: 680
Right 917062939 1:171059893-171059915 AGGGGAAGAAACTTAGAGGATGG 0: 3
1: 28
2: 199
3: 281
4: 621
917062932_917062939 4 Left 917062932 1:171059866-171059888 CCAGGGCCTGTCTGGGAGTGGGA 0: 1
1: 13
2: 130
3: 1016
4: 3472
Right 917062939 1:171059893-171059915 AGGGGAAGAAACTTAGAGGATGG 0: 3
1: 28
2: 199
3: 281
4: 621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917062939 Original CRISPR AGGGGAAGAAACTTAGAGGA TGG Intronic
902102512 1:14003217-14003239 AGAGGAGGGAACTTAGAGGGTGG + Intergenic
902775407 1:18671469-18671491 AGGGGAAGAAAGCCAGAGGTTGG + Intronic
903019129 1:20381332-20381354 AAGGGAAGAAACTTATTGAAGGG - Intergenic
903023216 1:20409064-20409086 AGGGGCAGCAACTTGGGGGAAGG - Intergenic
903200607 1:21735025-21735047 TGGGTAAGATACTTAAAGGAAGG + Intronic
903951579 1:26998805-26998827 AGGTGAAGAAACAGAGAGGGAGG + Intronic
904025614 1:27501534-27501556 AGGGGAGGGAACTTAGAGGATGG + Intergenic
904464910 1:30701918-30701940 AGGAGAAGAAGTTGAGAGGAGGG - Intergenic
904980728 1:34498959-34498981 AGGGGGAGCAATTTAGAGGCTGG - Intergenic
904982390 1:34517516-34517538 AGGGGAGGGAACTTAGGGAACGG + Intergenic
905349522 1:37335290-37335312 AGGGGAGGGAATTTAGAGGATGG + Intergenic
905981916 1:42236422-42236444 GTGGGAAGATACTTAGAGGCCGG - Intronic
906014569 1:42563469-42563491 AGGGGAGGGAACTTAGAGGATGG + Intronic
906075129 1:43046490-43046512 AGGGGAAGAGACTTAGAAGAGGG - Intergenic
906649433 1:47502240-47502262 ATAGGCAGAAACCTAGAGGAAGG - Intergenic
906894993 1:49761033-49761055 ATGGGAGGGAACTTAGAGGATGG + Intronic
907166656 1:52417538-52417560 AGGGGCAGAGAATTAGAGGATGG + Exonic
907625612 1:56026463-56026485 ATGGGAAGTACCTTAGGGGAGGG - Intergenic
907736872 1:57121797-57121819 AGGGGAGAGAACTTAGAGGACGG + Intronic
907800559 1:57761032-57761054 AGTTGAAGAAGCTTAGAGAATGG - Intronic
908435785 1:64104589-64104611 AGGGGAGGGAACTTAGAGGACGG - Intronic
909068715 1:70966576-70966598 AGGGGAGGGAACTTAGAGGATGG - Intronic
909119479 1:71583085-71583107 AGAGGAAGAAAATAAGAGGAAGG + Intronic
909191492 1:72558119-72558141 AAATGTAGAAACTTAGAGGATGG - Intergenic
909518558 1:76540370-76540392 AGGTGAGGGAACTTAGAGGACGG + Intronic
909842424 1:80344956-80344978 AGGGGAGGAAACTTAGAGGATGG + Intergenic
909854841 1:80515885-80515907 AGGGGAGGGAACTTAGAGGATGG - Intergenic
910076235 1:83282559-83282581 AGGGGAGGGAACTTAGAGGACGG - Intergenic
910118289 1:83756809-83756831 AAGAGAAGATACTTAGAGGAAGG + Intergenic
910293913 1:85625968-85625990 AGGGGAGGGAACTTAGAGGACGG - Intergenic
910517862 1:88083874-88083896 AGGGGAGGGAATTTAGAGGATGG - Intergenic
910574965 1:88751114-88751136 AGGGGAAAAAAATTAGAGCTGGG - Intronic
910617546 1:89216190-89216212 AGGGGAAGAAACTTAGAGGATGG - Intergenic
911574337 1:99557236-99557258 AGTGGGAGGAACTTAGAGCATGG - Intergenic
911774094 1:101786094-101786116 AGGTGGGGGAACTTAGAGGACGG + Intergenic
911871225 1:103101875-103101897 AGGAGAAAGAACTTAGAGAAAGG - Intronic
911970540 1:104429854-104429876 AGGGGAGGAAACCTAGAGGATGG + Intergenic
911979651 1:104551083-104551105 AGGGGAGGGAACTTAGAGGATGG + Intergenic
912608180 1:111014349-111014371 AGGGGAGGGAACTTAGAGGATGG + Intergenic
912918939 1:113846397-113846419 ATGGTAAGAAACATAAAGGAAGG - Intronic
913093965 1:115498701-115498723 TGAGGCAGAATCTTAGAGGATGG - Intergenic
913359544 1:117964568-117964590 AGGGGAGGAAGGTGAGAGGAAGG + Exonic
913373374 1:118125508-118125530 AGGGGAAGAAAGGGAGAGGTTGG - Intronic
913538565 1:119797435-119797457 AGAGGAATAAACTTATAAGAAGG - Intronic
914989267 1:152484477-152484499 AGAGGAAGAAACTGAGTGTAAGG - Intergenic
915033291 1:152902299-152902321 AGGTGCAGAAACTGAGAGGTGGG - Intergenic
915718963 1:157969905-157969927 AGGGGAGGAAATTTGGAGGCAGG - Intergenic
915731927 1:158060022-158060044 AGGAGCAGAGACTTGGAGGAAGG - Intronic
915930907 1:160060464-160060486 AGGGGAAGCATTTTAGATGAGGG + Intronic
916445179 1:164865167-164865189 AGGTGATGAAACTGAGATGAGGG + Intronic
916705495 1:167345064-167345086 AGGGGAGGGAACTTAGAGGACGG + Intronic
917024485 1:170627380-170627402 AGGGGAGGGAACTTAGAGGATGG - Intergenic
917026334 1:170646616-170646638 TGTAGAAGAAACTCAGAGGAAGG + Intergenic
917055944 1:170981621-170981643 CGGGGAGGGAACTTAAAGGACGG + Intronic
917062939 1:171059893-171059915 AGGGGAAGAAACTTAGAGGATGG + Intronic
917218885 1:172706409-172706431 TGGGAAAGAATCTTACAGGATGG - Intergenic
917355869 1:174125595-174125617 AGGGGAGGGAACTTAGAGGATGG - Intergenic
917431619 1:174975292-174975314 AGGGGAGCTAACTTAGATGAGGG + Intronic
917432370 1:174984154-174984176 AGGGGAGGGAACTTAGAGGATGG - Intronic
917602106 1:176586420-176586442 AGGGAGGGGAACTTAGAGGATGG - Intronic
917828206 1:178846953-178846975 AGGTGAAGAAACTGAGACAAAGG + Intronic
918122615 1:181552747-181552769 AGGGGAGGGAATTTAGAGGATGG - Intronic
918156782 1:181855080-181855102 AGGGGAGGGAACTTAGAAGATGG + Intergenic
918308647 1:183269604-183269626 AGGGGAAGAAACATTGATTAAGG + Intronic
918404291 1:184196089-184196111 AAGGGAGGGAACTTAGAAGATGG + Intergenic
918417013 1:184320457-184320479 CGGGGAGGGAACTTAGAGGACGG + Intergenic
918440243 1:184559550-184559572 AGGGGAAGAAAGAGAGAGGAAGG - Intronic
918599804 1:186343053-186343075 AGATGAAGAAACTAAGAGCAGGG + Intronic
918719051 1:187829344-187829366 AGGGGAAGGAAGAGAGAGGATGG - Intergenic
918885731 1:190191383-190191405 AGGGGAGGGAGCTTAGAGGATGG - Intronic
918903608 1:190460030-190460052 AAGAGAAGAAATTTAGAGAATGG - Intronic
918955693 1:191204146-191204168 AGGTGAAGGACCCTAGAGGATGG + Intergenic
919045536 1:192446875-192446897 AGGGGAGGAAACCTAGAGAATGG + Intergenic
919467981 1:197945385-197945407 AGGGGAGGGAATTTAGAGAATGG - Intergenic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
919986451 1:202679123-202679145 AGGAGAAGAAGCTGAGCGGAGGG - Intronic
920834278 1:209494055-209494077 AAGGGAAGAAACGCAGAGGTAGG + Intergenic
921303094 1:213769185-213769207 AGGGAAGGAAGCTAAGAGGAGGG + Intergenic
921455820 1:215370323-215370345 GGGGAAGGGAACTTAGAGGATGG - Intergenic
921735871 1:218627925-218627947 AGGGGAGGGAATTTAGAAGACGG - Intergenic
921862778 1:220056561-220056583 ATGAGAAGAGACTTACAGGAGGG + Intergenic
922367984 1:224883948-224883970 AAGGGCAGCAACTTGGAGGAAGG + Intergenic
922418325 1:225442208-225442230 AGGTGAAGAAACTGAAAGAATGG + Intergenic
922418508 1:225443428-225443450 AGGTGAAGAAACTGAAAGAATGG + Intergenic
923472219 1:234302053-234302075 AGGGAAGGGAACTGAGAGGACGG + Intronic
923857373 1:237859429-237859451 AGGGGACGGAACTGAGAGGACGG + Intergenic
924793044 1:247270475-247270497 AGGGGAGGGAACTTAGAAGATGG - Intergenic
1063076051 10:2717791-2717813 AGGGGAGGGAACTTAGAGGTTGG + Intergenic
1063265617 10:4446666-4446688 AGGGGAGGAAACTTAGAGGATGG + Intergenic
1063362247 10:5468226-5468248 AGGGCCAGTAACTTAGAGCAAGG + Intergenic
1064055809 10:12096211-12096233 AAGGAAATAAACTTGGAGGAGGG - Intronic
1064075214 10:12263472-12263494 ATAGGAAGAAAATTTGAGGAAGG - Intergenic
1065246569 10:23764808-23764830 AGGGGTGGGAACTTGGAGGATGG + Intronic
1065262090 10:23934394-23934416 AGGGGAGGGAGCTTAGAGAATGG + Intronic
1065274740 10:24074463-24074485 AGGGAAAGAATCAGAGAGGAAGG - Intronic
1065460723 10:25960756-25960778 GGTTGAAGAAAATTAGAGGATGG + Intronic
1065561310 10:26966495-26966517 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1065574064 10:27100804-27100826 AGGGGAATAAACTGAGAGATAGG - Intergenic
1066005750 10:31144715-31144737 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1066014662 10:31228770-31228792 AGGGGAGGTAACTTAGAGGATGG - Intergenic
1066274846 10:33858548-33858570 AGGGGGAGAAAATGGGAGGAAGG - Intergenic
1066525709 10:36276763-36276785 GGGGGAGGGAACTTAGAGGATGG + Intergenic
1066609317 10:37222252-37222274 AGGTGAAGAAACATGGAGGTGGG - Intronic
1067063883 10:43092927-43092949 AGGGGAAGGGAGTAAGAGGACGG - Intronic
1067956481 10:50796603-50796625 AGTGGAGGAAAATGAGAGGAAGG - Intronic
1068125600 10:52838830-52838852 AGGGGTGGGAACTTAGAGGACGG - Intergenic
1068147124 10:53086448-53086470 AGAGGAGGAAACTTGGAGGATGG - Intergenic
1068249294 10:54416252-54416274 AGGAGAGGCAACTTAAAGGACGG - Intronic
1068391766 10:56407533-56407555 AAAGGAGGGAACTTAGAGGATGG - Intergenic
1068455822 10:57252351-57252373 AGGAGAAGAAACTCAGGGAAAGG + Intergenic
1068502210 10:57854753-57854775 AGAGGAGGGAACTTAGAGGACGG - Intergenic
1068718396 10:60214488-60214510 AGGGGAGGGAACTTAGAGGATGG - Intronic
1068834114 10:61533517-61533539 AGGGGAGGGAGCTTAGAAGATGG - Intergenic
1068835960 10:61553918-61553940 AGGAGAAGGAATGTAGAGGATGG + Intergenic
1069536548 10:69257827-69257849 CTGGAAAGAAACTTAGAAGAGGG + Intronic
1070376834 10:75840636-75840658 AGGGGAAAAAACCTACAAGAAGG + Intronic
1071059601 10:81554131-81554153 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1071134008 10:82432591-82432613 ACAGGAGGGAACTTAGAGGACGG - Intronic
1071155461 10:82683318-82683340 AGAGGAAGAAAAAGAGAGGAAGG - Intronic
1071847811 10:89537409-89537431 AGGGCAGGAAACTGAGAGGAGGG - Intronic
1072239264 10:93480320-93480342 ATGGGAAGAAAGTTTGAGCAAGG + Intronic
1072849522 10:98873334-98873356 AGGGAAGGCAACTTAGAGGATGG - Intronic
1073232147 10:101981074-101981096 AGGGGAGGGAACTCGGAGGATGG + Intronic
1073516616 10:104081620-104081642 AGGAAGAGAAAGTTAGAGGAAGG - Intronic
1073585230 10:104703613-104703635 AGGGGAGGGAACTTAGAGGATGG + Intronic
1074136099 10:110627467-110627489 AGGTGAAGAAACTTAGCTTAGGG - Intergenic
1074480402 10:113815085-113815107 AGGGGAGGGAACTTAGAGGACGG + Intergenic
1074635811 10:115316085-115316107 AGGGGAAGAAACTCAGAGGATGG - Intronic
1075171448 10:120119453-120119475 AGGAGAGGAAACCTAGGGGACGG + Intergenic
1075384352 10:122044321-122044343 AGGGGAAGAAACATTTGGGATGG + Intronic
1075391757 10:122097400-122097422 AGAAGAAGAAACTCAGGGGAAGG + Intronic
1075394150 10:122114414-122114436 AGTTGATGGAACTTAGAGGAAGG + Intronic
1075909529 10:126112237-126112259 AGAGGAGGGAATTTAGAGGATGG + Intronic
1075915539 10:126163021-126163043 AGCGGGAGAAAGTGAGAGGAAGG - Intronic
1076412239 10:130260394-130260416 ACAGAAAGAAACTTAGAGAAGGG + Intergenic
1076515721 10:131043430-131043452 AGGGGATGCAACCTGGAGGATGG - Intergenic
1076666799 10:132097870-132097892 AAGGGAAGAAAATAAAAGGAAGG - Intergenic
1077586552 11:3458223-3458245 AAGGGAAAAAACTTAGAGACAGG + Intergenic
1077826303 11:5812087-5812109 AGGGGAGGGAACTTAAAGGATGG + Intronic
1077966245 11:7136749-7136771 AGGGGAGGGAACTTAGAGGTTGG - Intergenic
1078084204 11:8224151-8224173 AGGGGAAGAAGCTGGGAGGAAGG - Intergenic
1078440747 11:11365123-11365145 AGGGAAGGGAACTTAAAGGATGG - Intronic
1078534074 11:12159467-12159489 AGGGCAAGAAACGTGGATGACGG - Intronic
1078841346 11:15078052-15078074 AGGGGAAAAAAAGAAGAGGAGGG - Intronic
1079261109 11:18882283-18882305 AGGAGAGGGAACTTAGAGAATGG - Intergenic
1079292956 11:19204846-19204868 AGGAGAGGGAACTTAGAGGATGG + Intronic
1079482233 11:20893272-20893294 AGGGGAGGGAATTTAGAGGATGG + Intronic
1079965850 11:26979026-26979048 ACGGGAGGGAACTTAAAGGATGG - Intergenic
1080140367 11:28911268-28911290 AGGGAAAGAAAAATGGAGGATGG - Intergenic
1080164352 11:29219125-29219147 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1080557920 11:33433953-33433975 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1080602929 11:33838239-33838261 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1081051501 11:38347764-38347786 AGGGGAAGAGAGTAAGTGGAGGG + Intergenic
1081453777 11:43200680-43200702 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1081574413 11:44310260-44310282 AGGGGAAGAGAGAGAGAGGAGGG - Intergenic
1082262002 11:50083575-50083597 AGAGGGAGAGAATTAGAGGACGG - Intergenic
1082282783 11:50288085-50288107 ATGGGAAGAGGATTAGAGGAGGG - Intergenic
1082817604 11:57519693-57519715 AGGGGAGGGAACTTAGAGGACGG + Intergenic
1083179895 11:60978434-60978456 AGGAGAAGGAACCTTGAGGAGGG + Intronic
1083678494 11:64340780-64340802 CGGGGAAGGATCTGAGAGGAGGG + Intronic
1083946957 11:65929055-65929077 ATGGGAAGAAACTTGGAGAGGGG - Intergenic
1084082872 11:66840468-66840490 AGGGAAAGGAACTCAGGGGAAGG - Intronic
1084678631 11:70651878-70651900 AGTGGAAGAAATTTTGGGGATGG + Intronic
1084964063 11:72734639-72734661 AGGTGAAGAAACTGAGATAAAGG + Intronic
1085832112 11:79912461-79912483 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1085913057 11:80851227-80851249 AGGGGAAAAAATTCACAGGAGGG - Intergenic
1085979117 11:81701078-81701100 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1086041167 11:82481202-82481224 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1086418324 11:86612041-86612063 AGGGAAGGTAACTTAGAGGATGG - Intronic
1086794046 11:91078293-91078315 AGAGGAAGAAAGAAAGAGGAAGG - Intergenic
1086819989 11:91424084-91424106 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1087306940 11:96499755-96499777 AGGGTGAGAAACTTAGAGGAGGG - Intronic
1087426111 11:97988529-97988551 AGGTGAAGAGACATACAGGAAGG + Intergenic
1087552365 11:99667808-99667830 AGGGGAAGGAACTTAGAGGATGG + Intronic
1088083892 11:105955248-105955270 AGGGGAGGGAACTTAGAGGGCGG - Intronic
1088166999 11:106950868-106950890 AGGTCAGGGAACTTAGAGGATGG - Intronic
1088515148 11:110624528-110624550 AGGGGAGGGAACTTAGAGGACGG + Intronic
1088928401 11:114325091-114325113 TGGGGAGGGAACTTAGAGGATGG + Intergenic
1089092834 11:115892509-115892531 AGGGGCAGAAACACAGAAGAGGG - Intergenic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1090104345 11:123835875-123835897 AGGGGAGGAAACTTAGAGGATGG + Intergenic
1090122956 11:124052649-124052671 AGGGGAGGGAACTTAGAGGACGG + Intergenic
1090401629 11:126453027-126453049 AGGGGAGGAGACAAAGAGGAAGG - Intronic
1090429365 11:126633239-126633261 AGGGGAGGGAATGTAGAGGATGG + Intronic
1090535795 11:127640144-127640166 GGAGGAAGAAACACAGAGGAAGG - Intergenic
1090547786 11:127784428-127784450 AGGGGAAGGAAGTTAGGTGATGG + Intergenic
1090959972 11:131547428-131547450 ACGGGAAGAGACTTTGAGGTGGG + Intronic
1091652959 12:2323446-2323468 AGTGGCAGAATCTGAGAGGACGG + Intronic
1091911514 12:4234228-4234250 AGATGAGGAAATTTAGAGGAAGG - Intergenic
1092320335 12:7465939-7465961 AGGGGAGGGAACTTAGAGGATGG + Intronic
1092329030 12:7565781-7565803 AGGGGAGGGAACCTAGAGGATGG + Intergenic
1092478193 12:8836984-8837006 AGGGGAAGAGAGCTAGAGAAAGG + Intronic
1092628247 12:10351460-10351482 AGGGGAGGGACCTTAGAGGACGG - Intergenic
1093020406 12:14198274-14198296 GGGGGAGGGAACTTATAGGATGG - Intergenic
1093081546 12:14817457-14817479 AGGGGAGGGAACTTAAAGGATGG - Intronic
1093278500 12:17159855-17159877 AAGGGAAGAAAATAAGAGGAAGG - Intergenic
1093356069 12:18168972-18168994 AGAGTAAGAAACTCTGAGGATGG - Intronic
1093403938 12:18781493-18781515 AGGGGAGGGAAATTAGAGGATGG + Intergenic
1093523056 12:20072768-20072790 AGGGGAGGCAACTTAGGGGATGG + Intergenic
1093600436 12:21014930-21014952 AGGGGAGAGAACTGAGAGGATGG + Intergenic
1093666355 12:21817987-21818009 AGGGGAGGGAACTTAGAGGGTGG - Intronic
1093809010 12:23470258-23470280 AGGGGAGGGAACTTAGAGGGTGG + Intergenic
1094055247 12:26262481-26262503 AGGGGAAGGAACTTAGAGGATGG + Intronic
1094097041 12:26718179-26718201 AGGGGAGGGAACTTAGAGGACGG - Intronic
1094274372 12:28654602-28654624 AGGGGAGGGAACTGAGAGGATGG - Intergenic
1094706855 12:32922672-32922694 AGGGGAGGAAACAAAGATGATGG + Intergenic
1095319782 12:40813321-40813343 AGGGGAGGGAACTTAGAGGATGG - Intronic
1095604372 12:44049430-44049452 AGGGGAAGGAACTTAGAGGATGG + Intronic
1095786878 12:46119593-46119615 AAGGGGAGAAACTTAGAGGAGGG + Intergenic
1095857936 12:46881725-46881747 AGGGGAGGGAACTTAAAGGATGG + Intergenic
1096576394 12:52555530-52555552 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1097190906 12:57219224-57219246 AGGGAGAGAAACCTGGAGGAGGG - Intronic
1097280744 12:57844560-57844582 AGGGGAAGAAACCTAGATGTGGG - Intronic
1097291525 12:57920269-57920291 AGGGGAGGGAACTTAGAAAATGG - Intergenic
1097388646 12:58981654-58981676 AGGGGAGGGAACTTAGGGGATGG + Intergenic
1097438161 12:59576389-59576411 GAGGGAAGAAAACTAGAGGAAGG + Intergenic
1097741886 12:63252951-63252973 AGGGGAAGTGACCTAGGGGATGG - Intergenic
1097749506 12:63336622-63336644 AAGGAAGGGAACTTAGAGGATGG + Intergenic
1098073995 12:66706880-66706902 AGGGGAGGGAACTTGGAGGATGG + Intronic
1098480627 12:70955455-70955477 AGTGGTAGAAAATTAGATGACGG + Intergenic
1098633771 12:72756413-72756435 AAGGGAGGGAACTTAGAGGATGG + Intergenic
1099070554 12:78041323-78041345 AAGGGAAGAAATTTACAGGCTGG + Intronic
1099372850 12:81858816-81858838 AGGGGAGGCAACTTAGGGGATGG + Intergenic
1099514203 12:83576517-83576539 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1099792742 12:87357857-87357879 AGGGAAGGGAACTTAGAGGATGG - Intergenic
1100066065 12:90646636-90646658 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1100178354 12:92056721-92056743 AGGGGCGGGAACTTAGAGGACGG - Intronic
1100451101 12:94707131-94707153 AGTGGAAGAAACTCAGAACAAGG - Intergenic
1100907923 12:99322368-99322390 AGGGGAGTGAACTTAGAAGATGG + Intronic
1100960940 12:99962177-99962199 AGGGAAGAGAACTTAGAGGACGG - Intronic
1101451342 12:104781821-104781843 AGAGGAAGAAAGGTAAAGGATGG + Intergenic
1101794606 12:107961338-107961360 AAGGGAGGGAACTTAGAGGATGG - Intergenic
1101813439 12:108127818-108127840 AGAGGAAGAACCGAAGAGGAGGG + Intergenic
1102126859 12:110489857-110489879 AGAGTAAGAAACTTGGGGGAAGG + Intronic
1102230960 12:111261998-111262020 AGGGGAAGTCACTTGGGGGAGGG - Intronic
1102247720 12:111365776-111365798 AGGGGAGGGAACTTAGAGAACGG + Intronic
1102759012 12:115369013-115369035 AAGAAAAGAAACATAGAGGAAGG + Intergenic
1102937157 12:116907145-116907167 AGGGAATTAAACTCAGAGGATGG - Intergenic
1104488577 12:129174205-129174227 AGGGGAGTGAACTTAGAGGACGG - Intronic
1104540617 12:129661059-129661081 AGGGGAAGCATCTAAAAGGAGGG + Intronic
1105570130 13:21594892-21594914 AGGGGAGGGAACTTAGAGGATGG + Intronic
1105972286 13:25440309-25440331 AGGGGAAGGAAGAAAGAGGAAGG - Intronic
1106534035 13:30623203-30623225 AGGGGAAGCAAGTTCCAGGAAGG + Intronic
1106660127 13:31790828-31790850 AGGGGAAGAATCTTCCAGGCAGG + Intronic
1106948836 13:34859938-34859960 ATGGGAGGGAACTTAGAGGATGG + Intergenic
1108029512 13:46214739-46214761 AGGGGAGAAAACTTAGAGGATGG - Intronic
1108143620 13:47452936-47452958 AGAGGAGGGAACTTAGAGGATGG + Intergenic
1108440109 13:50443811-50443833 AAAGAAAGAAACTCAGAGGAGGG - Intronic
1109091662 13:58053418-58053440 AGGGGAAGAAATTTGGCTGAAGG + Intergenic
1109368695 13:61392898-61392920 AGGGAAAGATACTCAAAGGAGGG - Intergenic
1109568449 13:64152361-64152383 AGGGGAGGGAACTTAGAAGATGG - Intergenic
1109806400 13:67450264-67450286 AGGGGAGGGAACTCAAAGGATGG - Intergenic
1110258425 13:73457960-73457982 AGGAAAGGAAACTTAGAGGATGG - Intergenic
1110346680 13:74456225-74456247 AGGGGAGGGAACGTAGAGGATGG + Intergenic
1110386071 13:74912188-74912210 GGGGGAAGGAACATAGAGGGAGG + Intergenic
1110536129 13:76652635-76652657 GGGGGAGGGAACCTAGAGGACGG + Intergenic
1110693291 13:78457193-78457215 AGGGGAGGGAACCTAGAGGATGG + Intergenic
1110708845 13:78627404-78627426 AGGGGAGGGAATTTAGAGGATGG - Intronic
1110789879 13:79575991-79576013 AGGGGAGGGAACTTCGAGGATGG - Intergenic
1110813505 13:79836840-79836862 AGTGGAGGGAGCTTAGAGGATGG + Intergenic
1110983901 13:81939208-81939230 AGGGGAGGGAACTTAGAAGATGG + Intergenic
1111042851 13:82773025-82773047 CGGGGAGGGAACTTGGAGGAGGG - Intergenic
1111286597 13:86102133-86102155 TGGGGAGGGAACTTAGAGGATGG - Intergenic
1111320464 13:86621134-86621156 AGGGGAAGGAACCTAGAGGATGG + Intergenic
1111329842 13:86751061-86751083 AGGGCAGGGAACTTAGAGGACGG - Intergenic
1111699864 13:91673094-91673116 AGGGGAGGGAACTTAGAGGATGG + Intronic
1111775051 13:92650897-92650919 AGGGGAGGAAACTTAGAGGATGG - Intronic
1111907870 13:94276572-94276594 AGGGGTGGGAACTTAGAGGATGG - Intronic
1112094293 13:96115376-96115398 AGGGGAGGAAACTTAGAGAATGG - Intronic
1112329481 13:98465916-98465938 AGGGGAAGAAGCACAGAGGGTGG + Intronic
1112564174 13:100538135-100538157 AGATGAAGAAACTAAGATGAGGG + Intronic
1112852856 13:103728383-103728405 AGGGTAAGATTCTAAGAGGAAGG - Intergenic
1113384169 13:109833009-109833031 AGGGGAGGGAACTTAGACAATGG + Intergenic
1113680667 13:112242138-112242160 AAGGAAAGAAACAAAGAGGAAGG + Intergenic
1113722680 13:112572395-112572417 AGGGGCGGGAACTTAGAGGACGG - Intronic
1114035314 14:18620674-18620696 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1114123331 14:19694349-19694371 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1114706517 14:24732507-24732529 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1115554501 14:34533903-34533925 AGGGTAAGAACCCTATAGGAAGG + Intronic
1115928284 14:38462194-38462216 GGGGGAGGGGACTTAGAGGATGG - Intergenic
1116075547 14:40105758-40105780 AGGGGAGGGAACTTAGTGGATGG + Intergenic
1116758364 14:48978183-48978205 AGGGGAGGGAACTTAGAGGAAGG - Intergenic
1116909170 14:50439841-50439863 ATGGGAAGAAACTTTGGGAAGGG - Intronic
1116978055 14:51137798-51137820 AGGGGAGTGAACATAGAGGATGG + Intergenic
1117473845 14:56073990-56074012 GGGTGAAGAGACTTACAGGAGGG - Intergenic
1117651230 14:57907920-57907942 AGGGGAGGGAACTTAGAGGACGG - Intronic
1118345882 14:64940492-64940514 ATGGGAAGAAGCTTTGATGAAGG + Intronic
1118479534 14:66150142-66150164 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1118523466 14:66614843-66614865 AGGGGAAGGAACTTAGAGGATGG - Intronic
1118581179 14:67299886-67299908 AGCTGAAGAAACTCTGAGGATGG - Intronic
1119600025 14:75969395-75969417 AGGGAAAGAAACACAGAGGATGG + Intronic
1119771715 14:77224295-77224317 AGGGAAGGAAACTTAGAAGGCGG - Intronic
1120247475 14:82023984-82024006 AGGGAAGGGAACTTAGAGGACGG - Intergenic
1120261043 14:82186365-82186387 AGGGGAGGGAACTTAAAGTATGG + Intergenic
1120346235 14:83294040-83294062 AGGGGAGGAAAGCGAGAGGAAGG - Intergenic
1120604896 14:86562731-86562753 CGGGGAGGGAAGTTAGAGGACGG - Intergenic
1120673219 14:87388089-87388111 CCGGGAAGAATCTTACAGGAAGG + Intergenic
1121532182 14:94662751-94662773 AGGGGATGGAACTAAGAGAATGG - Intergenic
1121593338 14:95137414-95137436 AGGGGAAGGGAATAAGAGGAAGG + Intronic
1121905339 14:97736682-97736704 AGGGAAGGGAACATAGAGGAAGG - Intergenic
1121938766 14:98046756-98046778 AGGAGAGGGAACTTAGAGGACGG - Intergenic
1121947664 14:98138283-98138305 AGGGGAGGAAACAGAGATGAGGG - Intergenic
1122231864 14:100310174-100310196 AGGGGCACAAGCTTAGAGGGTGG - Intergenic
1122273526 14:100579360-100579382 AGGGAGATAAACTTAGAGAAGGG + Intronic
1122699586 14:103578950-103578972 AGAGGAAGAAACTGAGATGGAGG + Intronic
1124968420 15:34459012-34459034 AGGGGAGGAAACTTAGAGGATGG - Intergenic
1125375092 15:39020258-39020280 AGGGGAAGGAAATAAGAGAAAGG + Intergenic
1126277927 15:46906646-46906668 AGGGGAGGAAACTTAGAGGTTGG - Intergenic
1126350197 15:47738128-47738150 AGGGGAGGGAACTTAGAGGATGG - Intronic
1126776504 15:52104900-52104922 AGGGGAGGAAACTTAGAGGATGG + Intergenic
1126798856 15:52282331-52282353 AGGGGAGGAAAATGAGAAGAGGG - Intronic
1126840227 15:52710446-52710468 AGGGGAGGAAGCTGAGAGGTTGG - Intergenic
1126950261 15:53873065-53873087 AGGAGAAGAAAGGAAGAGGAAGG - Intergenic
1126956635 15:53940002-53940024 AGATGAAGGAACTTAGAGGAGGG + Intergenic
1126960232 15:53985074-53985096 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1127761296 15:62141896-62141918 ACGGGCAGCAACTTGGAGGAAGG + Intergenic
1128004145 15:64222290-64222312 GGGGGAGGGAACTTAGAAGACGG + Intronic
1128345902 15:66852323-66852345 AGGTGCAGAATCTGAGAGGAGGG - Intergenic
1128396288 15:67229612-67229634 AGGGGAAGAAAAGGAGAGGAAGG + Intronic
1128595027 15:68937592-68937614 AGGGGAGGGAACTTAAAGGATGG - Intronic
1128683669 15:69668563-69668585 AGGGGAAGAAAGGAGGAGGAGGG + Intergenic
1129120053 15:73390766-73390788 AGTGGAAGAAACCCAGAGGAGGG - Intergenic
1129789102 15:78328794-78328816 TAGGGAAGAAGCCTAGAGGAGGG + Intergenic
1129919045 15:79303053-79303075 AGGGGAGTGAATTTAGAGGATGG - Intergenic
1130166667 15:81468066-81468088 AGGGGAGGGAGCTTAGGGGATGG + Intergenic
1130175572 15:81565620-81565642 AGGGTAAGAGGTTTAGAGGATGG - Intergenic
1130333434 15:82938911-82938933 AGGTGATGAGACTCAGAGGAAGG - Intronic
1130430150 15:83839654-83839676 GTGGGAGGAAACGTAGAGGAAGG + Intronic
1131416038 15:92258648-92258670 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1132190799 15:99856025-99856047 AGGGGAGGAAACTTAGAGGATGG + Intergenic
1133295103 16:4747794-4747816 AGGTGCATGAACTTAGAGGAAGG + Intronic
1134248452 16:12557329-12557351 ATGGGAAGAACCTCAGAAGAGGG + Intronic
1134408140 16:13980907-13980929 TGGGGAAGGAACTTGGAGGAAGG + Intergenic
1134515782 16:14885711-14885733 AGGGGAAGAGGCAGAGAGGAGGG + Intronic
1134703453 16:16284355-16284377 AGGGGAAGAGGCAGAGAGGAGGG + Intronic
1134964090 16:18427759-18427781 AGGGGAAGAGGCAGAGAGGAGGG - Intronic
1134968377 16:18510295-18510317 AGGGGAAGAGGCAGAGAGGAGGG - Intronic
1135175233 16:20221935-20221957 AGGGGAGAAAAGTCAGAGGAAGG - Intergenic
1136016532 16:27404374-27404396 AGGAGAAGAAACTGGGAGGTGGG + Intronic
1136159393 16:28408750-28408772 AGGGGAATGAACTGAGCGGAAGG + Intergenic
1136203694 16:28706544-28706566 AGGGGAATGAACTGAGCGGAAGG - Intronic
1136645930 16:31614917-31614939 AGGGGAGGGAACATAGAAGATGG + Intergenic
1136659327 16:31742286-31742308 AGGGGAAGGAACATAGACAATGG - Intronic
1136909603 16:34135055-34135077 AGGGAAAGAAAAAGAGAGGAAGG - Intergenic
1137910293 16:52371235-52371257 AGGGGGAGAAATTCAGAGCATGG - Intergenic
1137993415 16:53183414-53183436 AGGGGAAGGAACAGGGAGGATGG + Intronic
1138120775 16:54399407-54399429 AGGGGGAAAAAATTAGAGTAGGG + Intergenic
1139097452 16:63722005-63722027 AGGGGAGGTAACTTAATGGATGG - Intergenic
1140434557 16:74935680-74935702 AAGTGAAGAAACTTAGAAAAGGG - Intronic
1140633196 16:76879723-76879745 AGGGGAAGAAATTGAGTGGCAGG + Intergenic
1141256963 16:82411502-82411524 TTGGGAAGAAACTTAGATCAAGG + Intergenic
1141393201 16:83681592-83681614 AGGGGAAGAAAGAGAAAGGAGGG - Intronic
1141551756 16:84810915-84810937 AGGGGCAGGAACTCAGGGGATGG + Intergenic
1141761025 16:86028856-86028878 TGGGAAAGAAACTCAGAGGAAGG - Intergenic
1141816458 16:86413072-86413094 AAGGGCAGAAACTCAGAGCAGGG - Intergenic
1142153246 16:88521860-88521882 GGGGGAGGAAACAGAGAGGAGGG - Intronic
1142750578 17:1985135-1985157 AGGTGAAGGAACTTCCAGGAAGG + Intronic
1142954146 17:3509293-3509315 AGGGGAGGGAACTTAGAGGATGG - Intronic
1143279700 17:5744038-5744060 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1143967510 17:10767400-10767422 ATGGGAATAAACTTGGAGGTGGG - Intergenic
1143981328 17:10872873-10872895 AGGGGAGGGAACGTAGAGGATGG - Intergenic
1145293651 17:21571285-21571307 AGGGGAGGGAACTTAAAGGATGG + Intronic
1145386329 17:22414654-22414676 AGGGGAGGGAACTTAAAGGATGG - Intergenic
1146138368 17:30343117-30343139 TGGGGAGCAAACTTAGGGGAAGG - Intergenic
1146552035 17:33788917-33788939 AGGGGAGAGAACTTAGATGATGG + Intronic
1146760255 17:35470786-35470808 AGGGGAGGGAACTCAGAGGATGG - Intronic
1146814413 17:35930869-35930891 AGGGGAACAGACTCAGAGGCTGG - Intergenic
1146891912 17:36511783-36511805 GGGGGCAGAAATGTAGAGGATGG - Intronic
1146942433 17:36852858-36852880 AGGGGAGAGAACTTAGAGGATGG + Intergenic
1147513162 17:41089887-41089909 AGAGGAGGGAACTTAGAGGATGG + Intronic
1147515231 17:41109891-41109913 AGAGGAGGGAATTTAGAGGATGG + Intergenic
1148396051 17:47309017-47309039 AGGGAAAGAAAAGGAGAGGAGGG - Intronic
1149377341 17:56058563-56058585 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1150428504 17:65096757-65096779 AGGGGAGGGAACTCAGAGGATGG + Intergenic
1150888717 17:69119451-69119473 AGGGGAATAAACTGAAAGTAGGG - Intronic
1151481545 17:74372585-74372607 AGGGGCAGAAGTGTAGAGGAGGG + Exonic
1152197158 17:78924758-78924780 AGGGAAAGAAAGGGAGAGGAGGG + Intronic
1152313536 17:79566179-79566201 AGTAGAAGAAACATAGAGGGAGG - Intergenic
1152521398 17:80858756-80858778 CTGGGAAGACATTTAGAGGAGGG + Intronic
1152760516 17:82104980-82105002 AGGAGAAGAAACTCACAGGGTGG - Intronic
1153125959 18:1790489-1790511 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1153150223 18:2084220-2084242 AGGGGAGAAAACTAAGAGAAAGG - Intergenic
1154387370 18:13906443-13906465 AGGGGAGGGAACTTAGAGGACGG + Intronic
1155378033 18:25183224-25183246 AGGGGAAGAAAGAGAGATGAGGG - Intronic
1155400267 18:25431048-25431070 GTGGGAGGGAACTTAGAGGACGG - Intergenic
1155754612 18:29474765-29474787 AGGGGAGGGAAATTAGAGGACGG + Intergenic
1155795653 18:30033746-30033768 AGGGGAGGGAACTTAGAAAATGG - Intergenic
1155825734 18:30440343-30440365 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1155848323 18:30736961-30736983 AGGGGAGGGAACTAAGAGGATGG + Intergenic
1156263993 18:35469464-35469486 AGAGGGAGGAACTTAGAGGCCGG - Intronic
1156419577 18:36936253-36936275 AAGGGAGGGAACTTAGAGGATGG - Intronic
1156430847 18:37072746-37072768 AGGGGAAGGAACTTAGGGAATGG - Intronic
1156606151 18:38669379-38669401 AGGGCAGGGAACTTAGAGGATGG + Intergenic
1156778889 18:40826179-40826201 AGGGGAGGGAATTTAGAGGATGG + Intergenic
1158419860 18:57283628-57283650 AGGGGAGGGATCTTACAGGATGG - Intergenic
1158462318 18:57657085-57657107 AGGGGAGGGAACCTAGAGGATGG - Intronic
1159154900 18:64571197-64571219 AGGGGAGGGAACGTAGAGGAGGG - Intergenic
1159256372 18:65952537-65952559 AGGGAAGGGAACTTAGAGGTTGG + Intergenic
1159392096 18:67806484-67806506 AGGGGAGGGAACTTAGAGAGGGG + Intergenic
1160965673 19:1746035-1746057 GGGGGAAGGAAAGTAGAGGAGGG + Intergenic
1161831997 19:6612890-6612912 AGAGGAGGCAACTTAGAGGACGG - Intergenic
1161854592 19:6756535-6756557 AGGGGAGGGAACTTAGAGGAGGG - Intronic
1162874480 19:13610566-13610588 AGGGGAAGAGACAGAGAGGGAGG + Intronic
1164425983 19:28142381-28142403 AGAGGAAGAAAGAGAGAGGAAGG + Intergenic
1164775586 19:30851063-30851085 AGGGGAAGAAGCTTCCAGGTTGG + Intergenic
1165302207 19:34977291-34977313 AAGGGAAGAAACTTTCATGATGG + Intergenic
1165656172 19:37534088-37534110 AGGAGAAGAAAAGAAGAGGAGGG - Intronic
1166084895 19:40467771-40467793 AGTGGAAGACACTTAGAGATGGG - Intronic
1166400392 19:42474834-42474856 AGGAGTAGAAATTGAGAGGAGGG + Intergenic
1166468745 19:43058956-43058978 ATGAGAAGAAAGTTGGAGGAGGG - Intronic
1166764553 19:45245138-45245160 AGGAGATGAAAATGAGAGGAGGG - Intronic
1166975654 19:46603655-46603677 AAGGGAAGAAACCTTGAGCAAGG + Intronic
1167129002 19:47572515-47572537 AAGGGAAGTTACTTAAAGGAGGG + Intergenic
1167231240 19:48285140-48285162 AGGGGAAGAAAGCAAGAGGAAGG - Intronic
1167361810 19:49034083-49034105 AGGGGAAGAAAAGAACAGGAAGG - Intronic
1167364267 19:49046769-49046791 AGGGGAAGAAAAGCACAGGAAGG + Intergenic
1167365540 19:49053361-49053383 AGGGGAAGAAAAGCACAGGAAGG + Intergenic
1167622835 19:50568553-50568575 GGGGGAAGAACCGGAGAGGATGG + Intergenic
1168141230 19:54388667-54388689 AGGGGGAGAAACTTGGAGGAGGG - Intergenic
1168275123 19:55273711-55273733 AGGGGAAGAAACTGAGGTGTGGG - Intronic
925132887 2:1505710-1505732 GAGGGGAGGAACTTAGAGGATGG - Intronic
925446897 2:3934308-3934330 AGGGGAGGGAACTTAGAGGAGGG - Intergenic
925667582 2:6277102-6277124 GGGGGAGGGAATTTAGAGGATGG + Intergenic
925871162 2:8271907-8271929 ATGGGAAGACATTGAGAGGATGG + Intergenic
926313954 2:11696160-11696182 AGGGGAGGGAACTTGGAGGACGG - Intronic
926369252 2:12163713-12163735 AGGGACTGAAACTGAGAGGAAGG - Intergenic
926392743 2:12410602-12410624 AGGAGAAGGAACTTAGAGCCTGG - Intergenic
926718791 2:15943337-15943359 AGGCGCAGGAACTTATAGGAGGG + Intronic
926820170 2:16843353-16843375 AGGGGAGGGAACTTAGAGAATGG - Intergenic
927590971 2:24357487-24357509 AGGGAAGGGGACTTAGAGGACGG + Intronic
928128364 2:28631358-28631380 AGGGGAAGCTCCTTAGAGGAGGG - Intronic
928353349 2:30584001-30584023 AGGGGAGGGAAGTTAGAGGAAGG - Intronic
929223227 2:39486645-39486667 AGAGGAAGAAAGAGAGAGGAAGG + Intergenic
929241903 2:39662339-39662361 AGTGGTAGAAATGTAGAGGAAGG + Intergenic
929293168 2:40216131-40216153 AGGGGAGGAAACTTAGAGGATGG - Intronic
929371267 2:41226375-41226397 TGGGGAGGGAACTTAGAGGATGG + Intergenic
929446970 2:42009409-42009431 AGTGGAAGAAGGTCAGAGGAAGG - Intergenic
929660631 2:43780686-43780708 AGTGGAAGGATTTTAGAGGAAGG + Intronic
929964341 2:46522370-46522392 AGGGGAGGAAACTTACAGGATGG - Intronic
930307332 2:49691984-49692006 AGGGGAGGGAACTTTGAGGATGG - Intergenic
930318188 2:49822723-49822745 AGGGTAGGGAACTTAGAGGATGG - Intergenic
930478598 2:51917287-51917309 AGGGGACAGAACTTAGAGGATGG + Intergenic
930861801 2:56081953-56081975 AGGGGAGGGAACTTAGAGGATGG + Intergenic
930952790 2:57163612-57163634 AGAGGAAGACAGTTAGAGGTTGG + Intergenic
931477100 2:62599667-62599689 AGGGGAGGGAACTTAAAGGACGG - Intergenic
931663677 2:64594475-64594497 AGGGGAAGAAACTAAGTAGTAGG + Intergenic
931934256 2:67178375-67178397 TGGGCAAGAAACTTAGCTGATGG - Intergenic
932014085 2:68006829-68006851 AGGGGAGGGAACTTAGAGGACGG + Intergenic
932781268 2:74560111-74560133 AGGGGAAGTAAGGAAGAGGAGGG + Intronic
932790616 2:74651774-74651796 AGAGGAAGAAACTCAGACGGGGG + Intergenic
932893054 2:75612523-75612545 AGCAGCAGAAACTAAGAGGAAGG - Intergenic
932941453 2:76171661-76171683 AGGAGACGGAACTTAGAGGATGG - Intergenic
933130037 2:78660790-78660812 AGGGGAGGGAACCTAGAGGACGG + Intergenic
933132527 2:78690268-78690290 AGGGGGTGAGACTTAGAGGATGG + Intergenic
933237166 2:79877944-79877966 AGGGAAGGGAACTTAGTGGATGG - Intronic
933250715 2:80025381-80025403 ATAGGAAGGAACATAGAGGAAGG + Intronic
933413533 2:81954768-81954790 AGGGAAGGGAACTTAGAGAATGG + Intergenic
933444001 2:82353972-82353994 AGGAGAGGGAACTTAGAGGATGG - Intergenic
933451072 2:82452861-82452883 AGGGGAGGGAACTTAAATGATGG - Intergenic
933601954 2:84341828-84341850 AGGGGAGGGAACTTAGAAGATGG - Intergenic
934019168 2:87926507-87926529 AGGGGAGGGAACTTAGAGGATGG + Intergenic
934727927 2:96637144-96637166 AGGGGCAGAAAGTCAGAGCATGG + Exonic
935231507 2:101101909-101101931 AGGGGAAGGAATGTAGAGGATGG + Intronic
935506438 2:103910578-103910600 AGGGGAGGGAAATTAGAGGATGG - Intergenic
935687684 2:105698547-105698569 AGGGGCAGAACCCTGGAGGAGGG - Intergenic
935920610 2:108009435-108009457 CAAGGAAGGAACTTAGAGGACGG - Intronic
936097855 2:109547188-109547210 AGAGGCAGCAACTTGGAGGAAGG - Intronic
936491104 2:112972825-112972847 AGTGAAAGGAACTTAGAGAATGG + Intergenic
936608647 2:113980368-113980390 AGAGGAAGAAAGGAAGAGGAAGG + Intergenic
936777967 2:115996763-115996785 AGGGGAGGGAACTTAGAGGACGG - Intergenic
936933100 2:117810341-117810363 AAGGGAGGGAACTTAGAGGATGG + Intergenic
937019416 2:118636619-118636641 AGGGGAGGGAAGTTAGAGGAGGG - Intergenic
937368516 2:121282270-121282292 AGGAAAAGAAACTTGGAGCAAGG - Intronic
937509853 2:122583104-122583126 AGGGGAAGGAAGGAAGAGGAAGG + Intergenic
937837997 2:126493268-126493290 AGGGGAGGGAACTTAGAGAATGG - Intergenic
937893396 2:126957743-126957765 AGGAGAAGGAACTTAGAGGATGG - Intergenic
938161927 2:128993646-128993668 AGGGGATGAAACTGGGAAGAAGG + Intergenic
938191536 2:129286443-129286465 AGGGAAGGGGACTTAGAGGATGG - Intergenic
938207287 2:129434838-129434860 AGGGGAGGGAACTTAGAGGATGG - Intergenic
938275933 2:130022217-130022239 AGGGGAGGGAACTTAGAGGACGG + Intergenic
938326884 2:130412936-130412958 AGGGGAGGGAACTTAGAGGACGG + Intergenic
938363060 2:130708523-130708545 AGGGGAGGGAACTTAGAGGACGG - Intergenic
938566153 2:132520871-132520893 AAGGGAAGAAATGCAGAGGAAGG + Intronic
938989180 2:136610377-136610399 GGGGGAGGGAACTTAGAGGAGGG + Intergenic
939257424 2:139761694-139761716 TTAGGAAAAAACTTAGAGGATGG - Intergenic
939391686 2:141576463-141576485 AGGGGAGGGAACTTAGAGGACGG + Intronic
939415686 2:141893894-141893916 AGAGGAAGAAACGAAGAGAAAGG - Intronic
939506169 2:143050279-143050301 AGGGGAGGGAACTTAGAGGACGG - Exonic
939514793 2:143152787-143152809 AAGAGAACAAACTTAGTGGAGGG + Intronic
939548820 2:143588184-143588206 AAGGGAAGAAAGTTAGATGGAGG - Intronic
939672029 2:145024649-145024671 AGGGGAGGGAACTTAGAGGACGG - Intergenic
939756793 2:146123726-146123748 AGTGGCAGAAACTTCCAGGAAGG + Intergenic
939809620 2:146814643-146814665 AGGAGAGGGAACTTACAGGATGG + Intergenic
940272774 2:151909546-151909568 AGGGGAGGGATCTTAGAGGGTGG - Intronic
940542882 2:155045122-155045144 AGGGGAAGAATCTTACAGTTTGG - Intergenic
941267274 2:163378281-163378303 AGGGGAGGGAACTTAGAGGATGG - Intergenic
941451553 2:165666288-165666310 AGAGGAAGAAAGAGAGAGGAAGG + Intronic
941521627 2:166552443-166552465 AGGAGATGGAACTTAGAGGCTGG + Intergenic
942194968 2:173508292-173508314 AGGCGAAGAGACTTATATGAAGG + Intergenic
942349986 2:175042220-175042242 AGGGGAGGGAACTTGGAGGACGG - Intergenic
942495204 2:176532828-176532850 AGGGGAAGAAAGTTTGGGAAGGG - Intergenic
942843440 2:180393625-180393647 AAGGGAGGAAACTTAGAGAATGG - Intergenic
942849394 2:180465991-180466013 TGGGGAAAAAACAAAGAGGAGGG - Intergenic
942924634 2:181417145-181417167 AGGGGAGGGAACTTAGAGAATGG + Intergenic
943001793 2:182336863-182336885 AGGGGAGGAAACTTAGAGGATGG + Intronic
943170854 2:184396896-184396918 AGGGGAGGGAACTTAGAGGATGG + Intergenic
943216517 2:185044355-185044377 AGGGGAGGGAACTTAGAGGATGG - Intergenic
943247156 2:185470441-185470463 AGGGCAAGGAACTAAGATGAAGG - Intergenic
943296629 2:186148315-186148337 AAGGGAGGGAACTTAGGGGATGG + Intergenic
943449682 2:188032578-188032600 AGATGAAGGAACTTATAGGAGGG - Intergenic
943492145 2:188567652-188567674 AGGGGAGGGAACTTAGAGGATGG + Intronic
943540090 2:189202957-189202979 AGGAAAAAATACTTAGAGGAGGG - Intergenic
943549876 2:189325386-189325408 AGGAGAAGGAACATGGAGGATGG - Intergenic
943600860 2:189919519-189919541 AGGGGAGGGAACTTAGACGATGG - Intronic
944580081 2:201124799-201124821 AGTAGAAGAAAGTTAGAGAAGGG + Intronic
945623168 2:212167953-212167975 AGGGGAGGGAACTTAGAGGATGG + Intronic
945626326 2:212211705-212211727 AGGGGAGGGAACTTAGAGGATGG - Intronic
945753890 2:213822704-213822726 AGGAGAGGGAACTTAGAGGACGG - Intronic
946113468 2:217440630-217440652 AGGGGAAGAAAATGAGGGGATGG - Intronic
946524443 2:220503510-220503532 AGAGGAAGAGGCTTAGAGGCTGG + Intergenic
946651972 2:221901942-221901964 AGGGGAGGAAACTTAGAGGATGG - Intergenic
946713192 2:222526876-222526898 GAGGGGAGGAACTTAGAGGATGG + Intronic
947449109 2:230189670-230189692 AGGGGAGGGAACTTAGAGGATGG - Intronic
947479568 2:230486308-230486330 AGGGGAGTGAACCTAGAGGATGG - Intronic
948117940 2:235507515-235507537 AAGGGAAGAAACCAGGAGGATGG - Intronic
948181482 2:235984579-235984601 AGGGGAAGGAACTTAGAAATGGG - Intronic
948219508 2:236258436-236258458 AGGGCAAGGGACTGAGAGGAAGG - Intronic
948798842 2:240420955-240420977 AGGATAAGAAAATTAGAGGATGG + Intergenic
1169312264 20:4554047-4554069 TGGGGAAGAACCCTAGAAGATGG + Intergenic
1170071757 20:12376694-12376716 AGGAAGAGAGACTTAGAGGAGGG - Intergenic
1170112649 20:12822404-12822426 AAGGGAGGGAACTTAGAGGACGG - Intergenic
1170237303 20:14120920-14120942 AGGGGAGGGAACTTAGAGGATGG + Intronic
1170663775 20:18367251-18367273 AGGGAAAGAACATTTGAGGATGG + Intergenic
1170801718 20:19595901-19595923 AGGAGAAGAAACTTCCAGGTGGG + Intronic
1170806586 20:19638047-19638069 GGGGGAAGGAACTTAGAGGATGG - Intronic
1170942707 20:20862528-20862550 ATGGGAAGAAACTTTGGGAAGGG - Intergenic
1171771436 20:29325702-29325724 AGGGAAAGAAAAAGAGAGGAAGG + Intergenic
1172485724 20:35296736-35296758 AGGGGAAGATGCTAACAGGAAGG + Intergenic
1172816803 20:37693863-37693885 GGGGGCGGAGACTTAGAGGAGGG - Intergenic
1173137430 20:40451605-40451627 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1173156077 20:40610333-40610355 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1173412320 20:42823402-42823424 AGGGGAGGGAACTTAGAGGATGG + Intronic
1173638568 20:44582591-44582613 CGGGGAAGAGACAGAGAGGAGGG + Exonic
1173697458 20:45031262-45031284 AGGGGAAGCAAGTCACAGGAAGG + Intronic
1174532221 20:51223159-51223181 AGGAGAAGAAAGAAAGAGGAGGG + Intergenic
1174559613 20:51421317-51421339 AGGGGAAGGAAGGTAGAGGGAGG + Intronic
1174927699 20:54778662-54778684 AGTGGTAGCAACTTGGAGGAAGG + Intergenic
1174945888 20:54984659-54984681 AGGGGAAGAAGCTGATAAGAAGG + Intergenic
1174974103 20:55311230-55311252 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1177227108 21:18271705-18271727 AGGGGAAGGAACTTAGAGGGCGG - Intronic
1177373279 21:20235067-20235089 AGGGGACAGAACTTAGAGGATGG - Intergenic
1177458173 21:21371151-21371173 AAGAGAAGAAACTTACAGGGAGG + Intronic
1177521275 21:22229968-22229990 AGGGGAAGTTACATAGAGGAAGG - Intergenic
1177655884 21:24016547-24016569 AAGAGAAGAAACTTAGACGCGGG - Intergenic
1177659725 21:24066956-24066978 AGGGGAGAGAACTTAGAGAATGG - Intergenic
1177668288 21:24190931-24190953 AGGGGAGGGAGCTTAGAGGATGG - Intergenic
1177812312 21:25937622-25937644 AAGGGAAGAATCTAAGAGGGAGG + Intronic
1177866625 21:26520206-26520228 AGGGGAGGGAACTTAGAGGATGG - Intronic
1179651476 21:42811978-42812000 AGATGAAGGAACTTACAGGAGGG - Intergenic
1180107072 21:45626148-45626170 AGGGGAGGGAAGCTAGAGGATGG - Intergenic
1180114844 21:45695537-45695559 AATGGAAGAAACTCAGAAGAGGG - Intronic
1180338501 22:11599957-11599979 AGGGAAAGAAAAAGAGAGGAAGG - Intergenic
1180434630 22:15288580-15288602 AAGGGAAGTGACTTAGAGAAGGG - Intergenic
1180459431 22:15547727-15547749 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1180639448 22:17286676-17286698 AGAGGCAGAGACTTTGAGGACGG + Intergenic
1181504945 22:23347468-23347490 AGGGGAGAGAACTTAGAGGATGG - Intergenic
1181656056 22:24300111-24300133 AGGGGAGAGAACTTAGAGGATGG - Intronic
1181898133 22:26129218-26129240 AAGGGAAGAGACTAAGAAGAAGG - Intergenic
1182072568 22:27474090-27474112 AGGTGAAGAAACTGAGAAGCGGG - Intergenic
1182618032 22:31601773-31601795 AGGTGAATAAGCTTAGATGAGGG - Intronic
1182767171 22:32765847-32765869 TGTGGAAGAACCTTAGAGAAGGG + Intronic
1182943483 22:34300488-34300510 AGGGGAAGAAAGGGAAAGGAAGG - Intergenic
1183056943 22:35312766-35312788 AGGGCAAGCCACATAGAGGAAGG + Intronic
1183172722 22:36199622-36199644 AGGAGAAGATAATCAGAGGAGGG + Intronic
1183180510 22:36257047-36257069 AGGAGAAGATAATCAGAGGACGG - Intronic
1183500281 22:38174772-38174794 AGGGGAAGGTGCTGAGAGGAGGG + Intronic
1184087709 22:42275178-42275200 AGGGAAAGAATGTAAGAGGACGG + Intronic
1184291794 22:43501348-43501370 AGGGGAGGAAAGATAGAAGAGGG - Intronic
949466510 3:4349848-4349870 AAGGGAAGGAAGTTGGAGGATGG + Intronic
949617154 3:5766296-5766318 AGGGGAGGGAACTTAGAGGATGG + Intergenic
951083004 3:18475029-18475051 ATGGGAGCAAACTTAGAGCATGG - Intergenic
951479025 3:23140056-23140078 AGTAGAAGTAACATAGAGGAGGG - Intergenic
951528008 3:23672090-23672112 AGTGGAGGAGACTTGGAGGAAGG - Intergenic
951674025 3:25216600-25216622 AGGGGAAGGAACTTAGAGGATGG + Intronic
952069712 3:29619168-29619190 AAGGGAGGGAACTTAGATGAAGG + Intronic
952679939 3:36079963-36079985 AGGGCAGAGAACTTAGAGGATGG - Intergenic
953253511 3:41267140-41267162 AGGGGAGGCAACTTAGAAGACGG - Intronic
953759618 3:45676431-45676453 AGGGGAGGGAACTTAGAGGATGG - Intronic
954765297 3:52910185-52910207 AAGGGAAGAAATTTAGAGAGGGG - Intronic
955003262 3:54946468-54946490 AGGGGAAGAAAATGAAAGGAGGG + Intronic
955063135 3:55511427-55511449 AGGGGAAGAAACACAGAGGAAGG + Intronic
955479199 3:59372104-59372126 TGGGGAAGAACTTTAGGGGAAGG + Intergenic
955482397 3:59402721-59402743 AGGGGAAGAAATAGAGGGGAGGG + Intergenic
955562746 3:60209949-60209971 TGGGGAGGGAACCTAGAGGATGG + Intronic
955720478 3:61875135-61875157 AAGAGAAGAAACTGAGAAGAGGG - Intronic
956542532 3:70357600-70357622 AGGGGAGGAAACTTAGAAGATGG + Intergenic
956616927 3:71181695-71181717 CTGGGAAGAAACTTAGAAGTGGG + Intronic
957013697 3:75038271-75038293 AGGGGAGGGAACATAGAGGATGG - Intergenic
957395302 3:79628497-79628519 AGGGAAGGGAACTTAGAGGATGG + Intronic
957490677 3:80922737-80922759 AGAGGAAGAAAATTTGAGCAAGG - Intergenic
957495300 3:80983855-80983877 AGAGGAAGCAAATTAGAGGGAGG - Intergenic
957530251 3:81431541-81431563 GGGGGAGGGAACTTAGAGGATGG + Intergenic
957706845 3:83799179-83799201 AGGGGCAGGAATTTGGAGGATGG - Intergenic
957861589 3:85958912-85958934 AGGGGAGGGAACCTAGATGATGG + Intronic
958007219 3:87827225-87827247 AGGGGAGGAAACTTAGAGGATGG - Intergenic
958046709 3:88293749-88293771 AGGGGAGGGGACTTAAAGGACGG - Intergenic
958258503 3:91352232-91352254 AGGGGTTGAAGCTTAAAGGAGGG - Intergenic
958655929 3:97003764-97003786 AGGGGAAGGAATTTAGAGGACGG - Intronic
958924135 3:100139205-100139227 AAGGGAGGGAACTTAGAGGATGG + Intronic
958984665 3:100766663-100766685 AGGGAAAGAAATTTAGAATAAGG + Intronic
959365423 3:105452197-105452219 GAGGGGAGGAACTTAGAGGATGG - Intronic
959417818 3:106098660-106098682 AGGGGAGGGAACTTAGAGGACGG - Intergenic
959453261 3:106528752-106528774 AGGGGAGGGAACTTAGAGGATGG + Intergenic
959578040 3:107956204-107956226 GAGGGAAGAAACTTACAGGAGGG - Intergenic
959618943 3:108379328-108379350 GGGGGAGGGAACCTAGAGGACGG + Intergenic
959962504 3:112314796-112314818 AGGGGAAGAAAAAAACAGGAAGG + Intergenic
959979094 3:112494767-112494789 AGGAGAGGGAACTTAGAGGATGG + Intronic
959991029 3:112632566-112632588 AGGGGGAGAAGACTAGAGGAGGG - Intronic
960040627 3:113146865-113146887 AGGGAAGGCAACTTGGAGGAAGG - Intergenic
960127643 3:114017748-114017770 AGGGGAGGAAACTTAGAGGATGG + Intronic
960160256 3:114342986-114343008 AAGGGAAGAAACTGAGGGGGAGG + Intronic
960234059 3:115260970-115260992 AGCGGAGGGATCTTAGAGGATGG + Intergenic
960374699 3:116885077-116885099 AGAGGAGGGAACTTAGAGGATGG - Intronic
960767502 3:121151709-121151731 AGGGAAAAAAAATAAGAGGAAGG - Intronic
961093093 3:124132404-124132426 AGGAGAAGAAACTTAGTGAGAGG + Intronic
961614286 3:128166658-128166680 AGGTGAAGAAGCTGAGAGGGTGG - Intronic
961921788 3:130434065-130434087 AGGCGAGGAAACTTAGAAGATGG - Intronic
961948045 3:130714581-130714603 AGGGGAGGGAACTTAGAGGATGG - Intronic
962201126 3:133401938-133401960 AGGGGGAGAGCCTGAGAGGATGG - Intronic
962204884 3:133426211-133426233 AGAGGCAGAAACTTGGGGGAGGG - Intronic
962377940 3:134874379-134874401 AGGGGAGAGAACTTAGAGGATGG + Intronic
962550608 3:136487107-136487129 AGGGGAGGGAACTTAGAGGACGG - Intronic
962694552 3:137935101-137935123 AGGGCATAAAACTTAGATGATGG - Intergenic
962701759 3:138007558-138007580 AGGGGAGGGAACCTAGATGATGG + Intronic
963063000 3:141240446-141240468 AGAGGAAGGAACATGGAGGATGG + Intronic
963219841 3:142797009-142797031 AGGGGAAGAAAAAAAGAGGAAGG - Intronic
963372430 3:144417855-144417877 AGGGGAGGGAACTTAGAGGATGG + Intergenic
963399908 3:144785423-144785445 AGGGGAAGGAACATAGAGGATGG - Intergenic
963460874 3:145613654-145613676 AAGGTAGGGAACTTAGAGGATGG - Intergenic
963488596 3:145969340-145969362 AGGGGAGGAAACTGAGACAAAGG - Intergenic
963677733 3:148334102-148334124 AGGGGAGGGTACTCAGAGGACGG - Intergenic
963741615 3:149086868-149086890 ATGAGAAGAAAATAAGAGGAAGG - Intergenic
963772521 3:149403018-149403040 AAGGGAGGGAACTTACAGGACGG - Intergenic
964168540 3:153738459-153738481 AGGGGAGGGAACTTAGACGACGG + Intergenic
964311181 3:155394884-155394906 AGGGAAGGAAAATTAGAGGATGG - Intronic
964633192 3:158834614-158834636 AGGGGAACAAATTTGGAGGCAGG + Intergenic
964992695 3:162833720-162833742 AGGGGAGGGAATTTAGAGGATGG + Intergenic
965176209 3:165336613-165336635 AAGAGAAGAAACAGAGAGGAAGG + Intergenic
965244861 3:166254702-166254724 AGGGCAGGGAACTTCGAGGATGG + Intergenic
965692595 3:171373379-171373401 AAGGGTGGAAACTTAGGGGAAGG - Intronic
965930038 3:174031005-174031027 AGGTGAAGAAATTTAAGGGAAGG + Intronic
965995420 3:174876371-174876393 AGGGGAAAAGAGCTAGAGGATGG - Intronic
966144675 3:176796672-176796694 AGGGTAAGGAAATGAGAGGAGGG + Intergenic
966237729 3:177720910-177720932 AGGGGAGGGAACTTAGAGGATGG - Intergenic
966373698 3:179274403-179274425 AGGGGTGGGAACTTAGAGGATGG - Intergenic
966539090 3:181069464-181069486 AGGGGAGAGAACTTAGAGGAGGG - Intergenic
966933131 3:184688587-184688609 AGTGGAAGGATCTTGGAGGAGGG + Intergenic
966962125 3:184950694-184950716 AGGGGAGGGAACTTAGAGGATGG - Intronic
967426062 3:189328850-189328872 AAGGGAGGGAACTTACAGGACGG - Intergenic
967447779 3:189586774-189586796 AGGGGGAGAAAATTTCAGGAAGG - Intergenic
968692787 4:2003744-2003766 AGGGGAGGGAACTTAAAGGACGG + Intronic
969107085 4:4815558-4815580 AGGAGAAGGAACTTAGAAGATGG + Intergenic
969138098 4:5047352-5047374 AGGGGAGGGAACCTAGAGGAGGG + Intergenic
969142342 4:5089314-5089336 AGGAGAGGGAACTTAGAGGATGG - Intronic
970225967 4:13857113-13857135 AGAGGAGGGAACTTAAAGGATGG - Intergenic
970250699 4:14112733-14112755 AGGGGAGGGAACCTAGAGGATGG - Intergenic
970385433 4:15551432-15551454 AGGTTAAGAAACATGGAGGAAGG - Intronic
970665964 4:18337397-18337419 AGGGGAGGGATCTTAGAGGATGG - Intergenic
970943958 4:21668243-21668265 AGGAGAGGGAACTTAGAGGATGG + Intronic
971124082 4:23733323-23733345 AGGTGAGGGAACTTAAAGGATGG + Intergenic
971358733 4:25917245-25917267 AAGTGAAGTAACTTAGATGAGGG - Intronic
971478476 4:27093583-27093605 AGGGGAGGGAGCTTAGAGAACGG + Intergenic
971517189 4:27501389-27501411 AGGGGAGGGGACTTAGATGATGG + Intergenic
972249883 4:37288167-37288189 AAGGGAGGGAACTTAGAGGATGG + Intronic
972681984 4:41315084-41315106 AGGGGAGGGAACTTAGAGGATGG + Intergenic
972944491 4:44237323-44237345 ATGGGAAGAAAGAGAGAGGAAGG - Intronic
972992419 4:44836958-44836980 AGAGGAACAAACTAGGAGGAAGG - Intergenic
973031625 4:45348991-45349013 AAGGGAAGGAACTTAGAAGATGG + Intergenic
973184324 4:47306550-47306572 AGGGGAAGGAAAAAAGAGGATGG - Intronic
973555464 4:52077279-52077301 ACGGGAAGAAACAAAGAGGAAGG - Intronic
973656948 4:53057565-53057587 AGGGGAGGGAACTTAGAGGACGG + Intronic
973958337 4:56085761-56085783 AGGGGAAGAAATGTAAAAGAAGG + Intergenic
974195736 4:58572442-58572464 AGGGCAAGAAAAAGAGAGGAGGG + Intergenic
974515816 4:62908561-62908583 AGGGGAGGGAGCTTAGAGGATGG - Intergenic
974908129 4:68082388-68082410 AGGGGGAGAGCCTTGGAGGATGG - Intronic
974931678 4:68367046-68367068 AGGGGAAGGAACTTAGAGGATGG + Intergenic
974968537 4:68795893-68795915 AGGGAAGGAAACTTAGAGGATGG + Intergenic
975001833 4:69234164-69234186 AGGGGAGGAAACTTAGAGGATGG - Intergenic
975003609 4:69257927-69257949 AGGGGAGGAAACTTAGAGGATGG + Intergenic
975011970 4:69366541-69366563 AGGGGAGGAAACTTAGAGGATGG + Intronic
975454003 4:74567317-74567339 AGGGGAGGGAACCTATAGGATGG + Intergenic
975526094 4:75352289-75352311 AGGGGAGGGAACCTAGATGATGG - Intergenic
975841730 4:78481422-78481444 GGGAGAAGAAACTTAGAGCCTGG - Intronic
975920876 4:79385612-79385634 AGGGGAAGACATTTAGATGACGG - Intergenic
975952864 4:79795007-79795029 AAGGGAGGGAACTTAGAGGATGG + Intergenic
976243821 4:82987506-82987528 AGGGGAGGGAACTTAGAGGTGGG - Intronic
976355576 4:84113311-84113333 AGGGAAGGGAACTTAGAGAATGG + Intergenic
976476826 4:85494254-85494276 AGGGGAGGGAAGTTAGAGGATGG - Intronic
976537643 4:86236965-86236987 AGGGGAGGCAACTTAGAGGATGG - Intronic
976693671 4:87895314-87895336 AGGGGAGGGAACTTAGACGATGG + Intergenic
976806869 4:89057898-89057920 AGGGGAGAGAACTTAGAGGATGG - Intronic
977125967 4:93168254-93168276 AGGGGAAGAAAGAAAGAGAAAGG + Intronic
977332228 4:95651783-95651805 AGGGAAAGAGAGCTAGAGGAAGG - Intergenic
977342184 4:95772777-95772799 AGGGGAGGGAACTTAGAGGATGG - Intergenic
977420473 4:96793608-96793630 AGGAGAGAGAACTTAGAGGATGG - Intergenic
978007293 4:103632552-103632574 AGGGGAGGGAACTTAGAGGATGG + Intronic
978166187 4:105610221-105610243 AGAGGAGGGAACTTAGAGGATGG + Intronic
978657412 4:111080554-111080576 AGAGGAGGAAACTTAGAGGACGG + Intergenic
978689619 4:111490655-111490677 AGAGGAGGAAACTTAGAGGACGG + Intergenic
978960564 4:114672679-114672701 AGGGGAGGGAACTTAGCGGATGG + Intronic
979004449 4:115273760-115273782 ATGGGAAGATATTTAAAGGATGG + Intergenic
979043387 4:115830490-115830512 AGGGGAAGGAACTTAGAGGACGG - Intergenic
979197318 4:117935959-117935981 AGGGGAGGGAACTTAGATGATGG - Intergenic
979518186 4:121635591-121635613 AGGGGAAGAGAATGAGAAGAGGG - Intergenic
979628015 4:122868247-122868269 AAAGGAGGGAACTTAGAGGATGG - Intronic
979735588 4:124078623-124078645 AGGGGAGGGAACTTAGAGGATGG + Intergenic
979953631 4:126926696-126926718 AGGCAAGGGAACTTAGAGGATGG + Intergenic
979978063 4:127221430-127221452 AAGGAAAGGACCTTAGAGGACGG - Intergenic
981014981 4:139964452-139964474 AGGGGAGGGAACTTAGAGGACGG + Intronic
981041757 4:140229747-140229769 AGGGGAAGGAACCTAGATGATGG - Intergenic
981279017 4:142935841-142935863 AGGGGAAGATTATTAGAGAAGGG - Intergenic
981540724 4:145843877-145843899 AGGAGAAGGAGCTGAGAGGAAGG - Intronic
981631335 4:146822211-146822233 AGGGGAGGGAACTTAGAGGATGG - Intronic
981681382 4:147403431-147403453 AGGGGAGGGAACTTAGAAGATGG - Intergenic
981900351 4:149854520-149854542 AGGGGAGAGAACTTAGAGGATGG + Intergenic
982030345 4:151294391-151294413 AGGAGTTGAAACTTAAAGGAAGG + Intronic
982333152 4:154204915-154204937 AAGAGAAGAAATTTAGAGGAGGG - Intergenic
982402694 4:154985721-154985743 AGGGGAGAAAGCTTAGAGGGCGG - Intergenic
982528830 4:156511887-156511909 AGGGGAGGGAACTTAGAGAACGG + Intergenic
982662458 4:158223539-158223561 AGGGGAGGGAACTTAAAGGATGG - Intronic
983231888 4:165137162-165137184 AAGAGTTGAAACTTAGAGGAAGG + Intronic
983402569 4:167284094-167284116 AGGGGCAGGAACTCAGAGGATGG - Intergenic
983727288 4:170944066-170944088 AGGGAAGGGAACTTAGAGGACGG + Intergenic
983747833 4:171223665-171223687 AGGGGAGGGCACTTAGAGGACGG + Intergenic
984092605 4:175392536-175392558 AGGGGAGGGAACTTAGAGGATGG + Intergenic
984216383 4:176917326-176917348 AGGGGAAGAAACTTAGAGGACGG + Intergenic
984234135 4:177135805-177135827 AGGGGAGGAAACCTAGATGATGG + Intergenic
984452313 4:179918423-179918445 AGGGGAGGGAACTTGGCGGATGG + Intergenic
984825962 4:183924698-183924720 AGAGGAAGAAACTGATAGGCCGG + Intronic
985235179 4:187865093-187865115 AGGGGAGAGAGCTTAGAGGATGG - Intergenic
985276922 4:188246210-188246232 GGGGGCAGAAACTTTGTGGAAGG + Intergenic
985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG + Intergenic
985877864 5:2613775-2613797 AGGGGAGGGAACATAAAGGATGG - Intergenic
986137905 5:4999784-4999806 AGGGGAGGGAACTTAGAGAATGG - Intergenic
986550450 5:8948235-8948257 AGAGAAAGACACTCAGAGGAAGG - Intergenic
986594856 5:9410722-9410744 AGGGGAGGAATCTTAGAGAGCGG + Intronic
986956255 5:13153749-13153771 AGGGGAGGAAACTTAGAGAATGG + Intergenic
987228279 5:15866639-15866661 AGGGGAGGGAAATTAAAGGATGG - Intronic
987399275 5:17458135-17458157 AGGAGAGGGAACTTAGAGAATGG - Intergenic
987458988 5:18184071-18184093 AGGAGAGGGAACTTAGAGGATGG - Intergenic
987540329 5:19246575-19246597 AGGAGAGGAAACTTAGAGGATGG + Intergenic
987834178 5:23140572-23140594 AGGGTAGGGAACTTAGAGGACGG - Intergenic
987927771 5:24364485-24364507 CAGGGAAGAAACTGAGAGGTGGG + Intergenic
988347520 5:30057365-30057387 AGGGAAGGGAACTTAGAGGAAGG + Intergenic
988510497 5:31860579-31860601 AGAAGGAGAAACTGAGAGGAGGG - Intronic
988673266 5:33405143-33405165 AGGGGAGGGAATTTAGAGGATGG + Intergenic
989017344 5:36954208-36954230 AAGGGTAGAAAGTGAGAGGATGG + Intronic
989193096 5:38690345-38690367 AGGGGAAGAAAGGGAGTGGAAGG - Intergenic
989246517 5:39261190-39261212 AGGGGAGGGAACATAGAGGATGG + Intronic
989347656 5:40448060-40448082 AGGGGAGGAAACCTAGATGATGG - Intergenic
989813781 5:45710842-45710864 TGTGGAGGGAACTTAGAGGATGG + Intergenic
990064692 5:51698128-51698150 AGGGGAGGGAACTTAGAGGATGG - Intergenic
990138511 5:52676765-52676787 AGGGGAGGGAACTTAGAGGATGG - Intergenic
990321206 5:54631722-54631744 AGAGGAGGAACCTTAAAGGATGG + Intergenic
990619430 5:57543789-57543811 AGGGGACGGAACCTAGACGATGG - Intergenic
990726092 5:58756506-58756528 AGGGGAGGGAACTTAGTTGATGG - Intronic
990840963 5:60078515-60078537 AGTGGAGGGAACTTAGAGGATGG - Intronic
990866754 5:60388483-60388505 AGGGGAGGGAACTTAGAGGATGG - Intronic
991189857 5:63857582-63857604 AGGGGAGGGAACTTAGAGGATGG - Intergenic
991214304 5:64144552-64144574 TGGGGAAGAAACTTAAATGAAGG + Intergenic
991605316 5:68395170-68395192 AGAGGAAGAATCTTACAGTATGG - Intergenic
992147052 5:73860955-73860977 AGTGGGGGAAACTGAGAGGAAGG - Intronic
992390173 5:76323902-76323924 AGGGGAGGGAACTTAGAGGATGG + Intronic
992973533 5:82087634-82087656 AGGGGAAGATTCTGAGAGCAGGG - Intronic
993116620 5:83726923-83726945 AGGGGAGGGAACTTAGAGGATGG - Intergenic
993253877 5:85562040-85562062 AGGGAAGGGAACTTAGAGGATGG + Intergenic
993544438 5:89194110-89194132 AGGGGAGGGAACTTAGAGCATGG - Intergenic
993669742 5:90746216-90746238 AGGGGAAGAGAATGAGAGGTGGG + Intronic
994345063 5:98674662-98674684 AGGGGAGGGAACTTAGAGGATGG + Intergenic
994729217 5:103472136-103472158 AGGGGTGGGAACTTAGAGGACGG - Intergenic
994920382 5:106035112-106035134 AGGGGAAGAAACATGGTGGCAGG + Intergenic
994952260 5:106479367-106479389 AGGGGAGGGAACTTAGAGGATGG + Intergenic
995028530 5:107452227-107452249 AGGGGAGGGAACTTAGAGGACGG + Intronic
995081347 5:108054125-108054147 AGGGGAGGGAACTTAGAGGATGG + Intronic
995138049 5:108701825-108701847 AGGGGAGGAAACCTAGATGATGG - Intergenic
995144737 5:108774028-108774050 AGGGGAGGGAACTTACAGGATGG - Intronic
995487194 5:112651248-112651270 AGGGGAAGAGAGAAAGAGGACGG - Intergenic
995666693 5:114550450-114550472 AGGGGAGGGAACTTAGAGGATGG + Intergenic
995684806 5:114760746-114760768 AGGGGAGGGAACTTAGAGGATGG - Intergenic
995959608 5:117823856-117823878 AGGGGAGGGAACTTAGAGGATGG - Intergenic
996108676 5:119538695-119538717 ATGGGAAGGAACTGAAAGGAAGG - Intronic
996287182 5:121808186-121808208 AGGGGAGGGAACTTAAAGGATGG - Intergenic
996485328 5:124026904-124026926 AGGGGGAGAAGAATAGAGGAAGG + Intergenic
996965208 5:129299893-129299915 AAGGGAGGGAACTTGGAGGATGG - Intergenic
997097983 5:130935059-130935081 AGGGGAGGGATCTTAGAGGATGG + Intergenic
997422409 5:133779843-133779865 AGAAGAAGAACCTGAGAGGAGGG + Intergenic
997653383 5:135538016-135538038 AGGAGAAGACACAGAGAGGAAGG - Intergenic
998016107 5:138733714-138733736 AGGGGAAGAACCCTATAGGCAGG + Intronic
998165512 5:139840363-139840385 AGGGGCAGAAGCTCAGATGAAGG + Intronic
998696313 5:144643908-144643930 AGGGGAGTGAACTTAGAGGATGG - Intergenic
998755102 5:145369250-145369272 AGGGAAGGGAACTTAGAAGATGG - Intergenic
998956440 5:147443495-147443517 ATGGGAGGGAACTCAGAGGATGG + Intronic
999361933 5:150992736-150992758 AGGGTGAGAAATATAGAGGAGGG + Intergenic
999692132 5:154157526-154157548 AGGGGAAGGCGCTTAGAGGAGGG - Intronic
999742245 5:154565218-154565240 AGGAAAAGAAAATTAGAGCAGGG + Intergenic
1000209826 5:159098755-159098777 AGGGGAAGAAAGGAAGAGGAAGG + Intronic
1000479021 5:161747906-161747928 AAGGGAGGGAACTTAGAGAATGG - Intergenic
1001163809 5:169345126-169345148 AGGGCTAGAAACCTAAAGGAAGG - Intergenic
1001188153 5:169598037-169598059 GGGGGAAGAATCTCAGAAGAGGG + Intronic
1001789424 5:174443094-174443116 AGGGGAGGGAACATAGAGGACGG + Intergenic
1001839161 5:174858980-174859002 AGGGGAGGGAACTTAGAGGAGGG - Intergenic
1002185721 5:177454066-177454088 AGGGGAGGAAAACTAGATGAGGG - Intronic
1002526844 5:179819888-179819910 AGGGGAGGAAACCCAGAGGGAGG - Intronic
1002917171 6:1538659-1538681 AGGGGAAGAAAGATGGAGAAGGG + Intergenic
1003249349 6:4412046-4412068 AGGGGAGGGAACTTAGGGGATGG + Intergenic
1003449847 6:6220340-6220362 AGGGGAAGTAATTTGGAGCAGGG + Intronic
1003705462 6:8523254-8523276 AGGGGAGGGAACCTAGAGGATGG + Intergenic
1003743190 6:8967245-8967267 AGTGGAAGCTACTTGGAGGAAGG - Intergenic
1003868233 6:10382155-10382177 AGGGGAAGGAGGTTAGAGGCTGG - Intergenic
1004094782 6:12542311-12542333 AGGGGAAGGAACTTAGAGGATGG - Intergenic
1004102888 6:12633027-12633049 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1004112451 6:12732453-12732475 AGGGAAGGGAACTTAGAGGATGG - Intronic
1005120478 6:22384127-22384149 AGGGGAGGGAACTTAGAAGATGG - Intergenic
1005487908 6:26318718-26318740 TGGGGATGAAACTGAGAAGAAGG + Intergenic
1006044125 6:31280033-31280055 AGGGACGGGAACTTAGAGGATGG + Intronic
1006053383 6:31361174-31361196 AGAGGAGGGAACTTAGAGGATGG + Intergenic
1007101663 6:39252116-39252138 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1007964815 6:45994504-45994526 AGGGGAGGGAATTCAGAGGATGG + Intronic
1008172317 6:48223496-48223518 AGGGGAGGAAACCTAGATGACGG + Intergenic
1008206843 6:48670462-48670484 AGGAGACGTAACTTAGAGGTGGG + Intergenic
1008467702 6:51849029-51849051 AGGGGAGGGAACTTAGAGGATGG - Intronic
1008596944 6:53052027-53052049 AGGGGAGGGAACTTACAGGACGG - Intronic
1008958287 6:57239783-57239805 AGGGGAAGGCACTTAAGGGAGGG - Intergenic
1008996760 6:57668455-57668477 AGGGGTTGAAGCTTAAAGGAGGG + Intergenic
1009185275 6:60567791-60567813 AGGGGTTGAAGCTTAAAGGAGGG + Intergenic
1009286078 6:61819397-61819419 AGGGGAAGAAAGTCACAGTAGGG - Intronic
1009573355 6:65418721-65418743 AGGGGAGGGAACGTAGAGGATGG + Intronic
1009590477 6:65663461-65663483 AGGAGAAGAAACTTAAAGAAAGG + Intronic
1009787933 6:68362500-68362522 AGAGGAGGGAACTTAGAGGATGG - Intergenic
1010068718 6:71717355-71717377 AGGGGAAAAAGCATAGATGAAGG - Intergenic
1010139109 6:72592921-72592943 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1010170749 6:72972470-72972492 AGGGGAGAAAACTTAGGGGATGG - Intronic
1010303142 6:74284976-74284998 AGAGGAGGGAACTTAGAGGATGG - Intergenic
1010482059 6:76367463-76367485 AGGGGAGGGAACTTAGACGATGG - Intergenic
1010576718 6:77540823-77540845 AGGGGAGGGAACTTATAGGATGG + Intergenic
1010946199 6:81976078-81976100 AGGGGAGGGAACTTACAGGATGG + Intergenic
1011177641 6:84582814-84582836 AGGGGACGTCACTTGGAGGAGGG - Intergenic
1011223747 6:85084859-85084881 AGGGGAGGGAAGTTAGAGGAAGG + Intergenic
1012038177 6:94169773-94169795 ATGGGAGTGAACTTAGAGGATGG + Intergenic
1012140703 6:95623698-95623720 AGGGGACGGAACTTAGAAGACGG - Intergenic
1012247583 6:96942961-96942983 AGGGCTAGAGATTTAGAGGAGGG + Intronic
1012434281 6:99198534-99198556 AGGGGAGGGAATTTAGAGGATGG - Intergenic
1012573237 6:100758346-100758368 AGGGGAGGGAACTTAGAGGATGG - Intronic
1013379361 6:109551859-109551881 AGAGGAAGGAACGTAGAGGATGG - Intronic
1013423704 6:109990824-109990846 AGAGGAGGGAACTTAGAAGATGG + Intergenic
1013740953 6:113283943-113283965 ACGGGAGGGAACTTAGAGAATGG + Intergenic
1014338891 6:120176780-120176802 AGGTGAGAGAACTTAGAGGATGG + Intergenic
1014368876 6:120580289-120580311 AGGTGAGGGAACTTAGAGGATGG - Intergenic
1014385676 6:120798868-120798890 AAGGGAGGGAACTTAGAGGAAGG + Intergenic
1014582334 6:123154278-123154300 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1014965051 6:127737952-127737974 AGGGAAAGAGACTTCAAGGAAGG + Intronic
1015036506 6:128661729-128661751 AGGGGAGAGAACTTAGAGGATGG + Intergenic
1015471644 6:133612839-133612861 AGAGGAAGAAGCATGGAGGAGGG - Intergenic
1016140170 6:140598552-140598574 AGGGGAGGGAACTTAGAGGGTGG + Intergenic
1016202980 6:141435054-141435076 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1016293457 6:142549157-142549179 AGAGCAAGAAGCTTAGAGCAGGG + Intergenic
1016669585 6:146687657-146687679 AGGGGAGGGAACTTAGAGAATGG + Intronic
1016841642 6:148531892-148531914 AGGGAAAGCATCTCAGAGGAAGG + Intronic
1017279499 6:152608047-152608069 AGGGGAGGGAACCTAGATGATGG + Intronic
1017377291 6:153786064-153786086 AGGGGAGTGAACTTAGAGGATGG + Intergenic
1017576179 6:155807217-155807239 AGGGGAAGAAGAAGAGAGGAGGG + Intergenic
1017748466 6:157468139-157468161 AGGGAAAGAACCTGAGTGGAGGG + Intronic
1018054684 6:160041493-160041515 AGGGGAGGGAACTTAGAGGATGG + Intronic
1018186366 6:161268437-161268459 AGGGGAGGGAACTTAGAGGATGG - Intronic
1018201883 6:161402744-161402766 AGGGGGAGGAGGTTAGAGGAGGG + Intronic
1018319253 6:162588992-162589014 AGTGGAAGAGAGTGAGAGGATGG - Intronic
1018513172 6:164549061-164549083 AGGGAAGGGAACTTAGAGGATGG - Intergenic
1019112975 6:169732416-169732438 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1019796772 7:3055562-3055584 AGGGGAAGAACCACAGAAGATGG - Intergenic
1019825299 7:3279499-3279521 AGTGGGAGAAACAGAGAGGAAGG + Intergenic
1020488613 7:8750423-8750445 AGGGGAGGGAACTTAGAGAACGG - Intronic
1020622653 7:10536387-10536409 AAGGGAGGAAACTTAGAGGATGG + Intergenic
1020633260 7:10666606-10666628 AGGGGAGGGAACTTAGAGAATGG - Intergenic
1020869757 7:13612921-13612943 AGGGAAGGGAACTTAGAGGATGG + Intergenic
1021148259 7:17116834-17116856 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1021185895 7:17564303-17564325 AGGGGAGGGAATTTAGAGGATGG + Intergenic
1021187601 7:17583374-17583396 AGCAGAGGGAACTTAGAGGATGG + Intergenic
1021446149 7:20735768-20735790 AGGGGAAAACACAGAGAGGAAGG + Intronic
1022039291 7:26564844-26564866 AGGGGAGGAAAACTAGAGGATGG + Intergenic
1022215510 7:28256700-28256722 AGAAGAGGGAACTTAGAGGATGG - Intergenic
1022624615 7:32022157-32022179 AAAGGAAGAAAGTGAGAGGAAGG + Intronic
1022635205 7:32125732-32125754 AGGGGAGGGAACTTAGAGGATGG + Intronic
1022640033 7:32173374-32173396 AGGGGAGGGAGCTTACAGGACGG + Intronic
1023362996 7:39434762-39434784 TGAGGAGGGAACTTAGAGGATGG - Intronic
1023487219 7:40699979-40700001 AGGGGAAAAAAGTTTCAGGAAGG - Intronic
1023747586 7:43336052-43336074 AGGGGAAGAAAGAGAGAGGAAGG - Intronic
1023769110 7:43538477-43538499 AGAAGAAGAAACTGAGAAGAGGG + Intronic
1023890682 7:44389770-44389792 GGGGAAAGAGACTGAGAGGAAGG + Intronic
1024067383 7:45751952-45751974 ATGGGAAGAGGATTAGAGGAGGG - Intergenic
1024119677 7:46224032-46224054 AGGGGAGGGAACTTAGAGGACGG + Intergenic
1024979221 7:55143643-55143665 AGGGGAAGTTACTGAGAAGATGG + Intronic
1025089274 7:56049225-56049247 AGGGTTTAAAACTTAGAGGATGG - Intronic
1025872862 7:65451152-65451174 AAGTGAAGAAACTTAGATGAAGG + Intergenic
1026661731 7:72308733-72308755 CCGGGAAGGAACTAAGAGGAGGG - Intronic
1027022028 7:74822010-74822032 AGGGGAGGGAACTTAGAGGATGG - Intronic
1027065991 7:75123908-75123930 AGGGGAGGGAACTTAGAGGACGG + Intronic
1027294009 7:76747852-76747874 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1027803114 7:82781424-82781446 AAGGGAGGCAACTTAAAGGACGG - Intronic
1027837665 7:83265599-83265621 AGGGGAGGGAACTTAGAGGACGG + Intergenic
1027859986 7:83565407-83565429 AGGGGAGGGAACTTGGAGGATGG + Intronic
1027945130 7:84734675-84734697 AGGGGAGGGAACTTAAAGGATGG + Intergenic
1027968900 7:85051209-85051231 AGGTTAAGAAACTGAGAGAATGG + Intronic
1028443063 7:90885921-90885943 AGGAGAGGGAACTTAGAGGACGG + Intronic
1028863209 7:95678417-95678439 AGGTGTAGAAACATAGAAGATGG - Intergenic
1028881614 7:95886560-95886582 ATGGGAAGAAACTTAAAGTCAGG - Intronic
1028928981 7:96391910-96391932 TGGGGAAAAATGTTAGAGGACGG - Intergenic
1029040026 7:97563504-97563526 AGGGGAAGGAACTTAGATGATGG + Intergenic
1029228111 7:99043363-99043385 ATGGGATGATACTTAGAGAACGG - Intronic
1029286819 7:99471479-99471501 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1030484998 7:110154164-110154186 AGGGGCAGAGAGTTGGAGGAGGG - Intergenic
1030759924 7:113337690-113337712 AGAGGAGGGAACTTAGAGGATGG + Intergenic
1030867304 7:114715076-114715098 AGGGGAAGAAACCAAGAGAATGG + Intergenic
1030906269 7:115187347-115187369 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1031103801 7:117514286-117514308 AGGGGAGGGAACTTAGAGGATGG - Intronic
1031272352 7:119667241-119667263 AGGGGAGGAAACCTAGATGATGG + Intergenic
1031307856 7:120155422-120155444 AGGGGAGGGAACTTACAGGATGG + Intergenic
1031312179 7:120212116-120212138 AGGGGAGAGAACTTAGAGGATGG + Intergenic
1031652426 7:124306699-124306721 AGGGAAAGAAACTCAGTGCAAGG - Intergenic
1031653359 7:124319916-124319938 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1031805109 7:126298263-126298285 AGGAGAGGGAACTTAGAGGATGG + Intergenic
1032140061 7:129320744-129320766 AGGGGAATTTATTTAGAGGATGG - Intronic
1032356107 7:131212254-131212276 CAGGGAAGGAATTTAGAGGAAGG - Intronic
1032890126 7:136185559-136185581 AGGGGAGGGAACCTAGATGACGG - Intergenic
1032945014 7:136840338-136840360 AGGGGAGGGAACTTAGAGGGCGG + Intergenic
1033469830 7:141635689-141635711 AGGGTACAAAACTTAGAGTATGG - Intronic
1033550597 7:142443908-142443930 AGGGTAAGAAGCAAAGAGGAAGG - Intergenic
1033609630 7:142953343-142953365 AGGGGAAGAAAGGAAGAGGAGGG - Intronic
1033784139 7:144709943-144709965 AGGAGAAGAAATTAAGAGGATGG - Intronic
1033983422 7:147194058-147194080 AGGGGATGGAACTTAGAGGAGGG - Intronic
1034843745 7:154423893-154423915 AGGCAAAGAAACATAGAGGATGG + Intronic
1035100194 7:156389860-156389882 AAGGGAAGAAGCTCTGAGGAGGG - Intergenic
1035598973 8:883767-883789 GGGGGAGGAAACTTACAGGATGG - Intergenic
1035867341 8:3099258-3099280 AGATGAAGGAACTTACAGGAGGG - Intronic
1035936416 8:3846462-3846484 ACGTGAAAAAACTGAGAGGAAGG - Intronic
1036004600 8:4647542-4647564 AGGGGAGGGAACTTAGAGGAGGG - Intronic
1036684065 8:10897240-10897262 AGGGGGAGAAACTGAAAAGAGGG + Exonic
1037235590 8:16715967-16715989 AGGGAAGGGAACTGAGAGGATGG - Intergenic
1037359653 8:18059868-18059890 AGGGCTTGAAACTTAGATGATGG - Intronic
1037395028 8:18432583-18432605 AGGGGAGGGAATTTATAGGATGG + Intergenic
1037685231 8:21133092-21133114 AGGGGAGGGAATTAAGAGGATGG - Intergenic
1038087957 8:24221033-24221055 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1038242782 8:25825326-25825348 AGGGGAGGGAACTTAGAGTATGG - Intergenic
1038507945 8:28101989-28102011 AGAGGAAGAAACAGAGAGGGTGG - Intronic
1038746432 8:30259021-30259043 ATGAGAAGAAATTGAGAGGATGG - Intergenic
1039030515 8:33304091-33304113 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1039402789 8:37285256-37285278 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1040647443 8:49415904-49415926 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1040943389 8:52855083-52855105 AGGGGAGAAAACCTAGAGGCAGG - Intergenic
1041001087 8:53454275-53454297 AGGGGAGGGAACGTAGAGGATGG + Intergenic
1041508030 8:58622873-58622895 AGGAGAAGAAAAGTAGAGAAGGG + Intronic
1041891694 8:62876823-62876845 GAGGCAAGGAACTTAGAGGATGG + Intronic
1041971078 8:63743272-63743294 AGGGGAGGGAACTTAGAGGACGG + Intergenic
1042037930 8:64557407-64557429 AAGGGAAGAAAGATATAGGAGGG + Intergenic
1042693941 8:71534766-71534788 AGGGGAAGGAATTCAGAGGATGG + Intronic
1042995952 8:74698795-74698817 AGGGGAGGAAACTTAGAGGATGG + Intronic
1043176193 8:77026009-77026031 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1044000902 8:86879903-86879925 TGGGGGAGGAACTTAGAGGGTGG + Intronic
1044176702 8:89133950-89133972 AGGAGAAGAACCTTAGTGAAAGG + Intergenic
1044355698 8:91220478-91220500 AGGGGAGGGGACTTATAGGATGG - Intronic
1045286787 8:100798557-100798579 AGGGGAAGAAAATGAGGCGATGG - Intergenic
1045704920 8:104911340-104911362 AGGGGAGGGAACTTAGAGGATGG - Intronic
1045829758 8:106444700-106444722 AGGGGCAGGAACTTAGAGGACGG + Intronic
1045844047 8:106612848-106612870 AGGTGATGAAACTGAGAGGCAGG + Intronic
1045948404 8:107824223-107824245 AGGGGAGGGAACCTAGATGATGG - Intergenic
1046385059 8:113498605-113498627 ATGGGAGGGAACTTAGAGGATGG - Intergenic
1046570749 8:115962558-115962580 AGAGAAAGAAACGTAGAGAAGGG + Intergenic
1046588433 8:116176210-116176232 AAGGAAAGAAAGTTAAAGGAAGG + Intergenic
1048054010 8:130846676-130846698 AGGGGAAGAAAGGAAGGGGAAGG - Intronic
1048373241 8:133798808-133798830 AGGGTAAGAAACTTAGAGGATGG + Intergenic
1048384674 8:133901086-133901108 AGGGAATGAAAATTTGAGGATGG - Intergenic
1048431497 8:134375697-134375719 AGGGGAGGAAAGGGAGAGGAGGG - Intergenic
1048587154 8:135784975-135784997 AGGGAAAGAAACCTAGATGATGG - Intergenic
1049523272 8:143106084-143106106 ACAGGAGGGAACTTAGAGGATGG + Intergenic
1049856862 8:144867761-144867783 AGGGTGAGAAATTTAGAGGATGG + Intergenic
1049919396 9:349102-349124 AAGGGAAGAAACTGAGTGGGAGG + Intronic
1050630599 9:7554638-7554660 AGGGGAAAGAACTTAGAGGATGG + Intergenic
1051087811 9:13371224-13371246 AAGGGGAGAAAATGAGAGGATGG - Intergenic
1051350735 9:16195913-16195935 AGGGCCAGAAACTGAGAGCATGG + Intergenic
1051438235 9:17055268-17055290 AGGAAAGGGAACTTAGAGGATGG - Intergenic
1051492534 9:17682568-17682590 AGGGGAGGGAACTTAGAGGATGG + Intronic
1051706684 9:19888356-19888378 AGGGTCAGAAAATTAGAGAAAGG - Intergenic
1052267200 9:26588704-26588726 AGGAGAGGGAACTTAGAGGATGG - Intergenic
1052433840 9:28401264-28401286 AGGGGAGGGAGCTTAGAGGATGG - Intronic
1052547200 9:29894608-29894630 AGGGGAGGGAACTTATAGGATGG + Intergenic
1052762604 9:32608155-32608177 AGGGAAGGGAACTTAGAGAATGG - Intergenic
1053379101 9:37634857-37634879 AGGGGAGGGAACTTACAGGGTGG - Intronic
1055180618 9:73381568-73381590 AGGAGAAGAAACAGAGAAGATGG + Intergenic
1055735495 9:79324968-79324990 AAGGGAAGAAATTAAGATGAAGG - Intergenic
1056002713 9:82233812-82233834 AAGAGAGGGAACTTAGAGGATGG + Intergenic
1056002909 9:82236459-82236481 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1056313337 9:85365204-85365226 AGGGGAGGGAACTTAAAGGATGG - Intergenic
1056723272 9:89089622-89089644 AAGGAAATAAACTCAGAGGAGGG + Intronic
1056892492 9:90508963-90508985 AGGAGAAGAATTTTAGAGCAGGG + Intergenic
1057290866 9:93806654-93806676 AGGAGAGGAAACTTAGAGGATGG + Intergenic
1058033235 9:100222850-100222872 ATGGCAAGAAATTTAGAGCAGGG + Intronic
1058044202 9:100338458-100338480 AAGGGAAGAAGCTTGGAGGAAGG - Intronic
1058110483 9:101027312-101027334 AGGAGAACAGACTTAGAGGAAGG - Intergenic
1058160710 9:101567722-101567744 AGGTGAAGAGACTCAGTGGAGGG - Intergenic
1058185827 9:101853361-101853383 AGGGGAGGGAACTTAGAAGGGGG + Intergenic
1058346635 9:103971509-103971531 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1058528149 9:105880436-105880458 AGGGTAAGAACCTTTGAGGGTGG + Intergenic
1058849756 9:109000030-109000052 AGGGGAAGAGAATTACAAGAAGG + Intronic
1059455104 9:114395404-114395426 AGGGGAAAAACCTGACAGGATGG - Intergenic
1059596823 9:115729848-115729870 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1059779679 9:117513327-117513349 ATGGGGAGAAACTCAGAAGAAGG + Intergenic
1060026660 9:120177730-120177752 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1060130107 9:121087910-121087932 AAAGGAAGAAACTTTGAGGAAGG + Intronic
1061733277 9:132633698-132633720 AGGGGAGGAAAAGAAGAGGAAGG + Intronic
1061858457 9:133455782-133455804 AGGGGAAGTAACTTGAAGGTAGG + Intronic
1061938553 9:133871961-133871983 TGGGGCAGACACTCAGAGGAAGG - Intronic
1062421723 9:136485634-136485656 AGGGGCAGAGACTTGGAGAATGG - Exonic
1203365126 Un_KI270442v1:249492-249514 AGGGAAAGAAAAAGAGAGGAAGG + Intergenic
1186001954 X:5022427-5022449 AGGGGGAGACACAGAGAGGAGGG - Intergenic
1186082492 X:5948599-5948621 AAGGGAAGAAAATTGGAGGCTGG - Intronic
1186206848 X:7209753-7209775 ACGGGAAGAAACTTAGAGGATGG - Intergenic
1186366132 X:8895514-8895536 AGGGGAGGGAACTTAGAGGACGG + Intergenic
1186379463 X:9042746-9042768 AGGGGAGGGAACTTAGAGAATGG - Intronic
1186435443 X:9539033-9539055 ATGGGGAGATACTGAGAGGAGGG + Intronic
1187102892 X:16213033-16213055 AGGAGGAAAAACTTAGAAGAGGG - Intergenic
1187272833 X:17794050-17794072 AGGGGAAACCACTTAGGGGAGGG + Intergenic
1187478747 X:19635433-19635455 AGGGGAGGGAACTTAGAGGATGG + Intronic
1187562060 X:20412527-20412549 AGGGGAGGGAGCTTAGAGAATGG - Intergenic
1187807646 X:23138487-23138509 AGGGAAAAAATCTTAGAGTAGGG - Intergenic
1188037520 X:25335256-25335278 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1188295337 X:28440698-28440720 AGAGGAAGCAACAGAGAGGAGGG - Intergenic
1188546463 X:31312967-31312989 AAGGGAGGGAACTTAGACGATGG + Intronic
1188785944 X:34346446-34346468 AGGGGAGGGAATTTATAGGATGG + Intergenic
1188826769 X:34845003-34845025 AGGGGAGGGAATTTAGAGGATGG - Intergenic
1189168910 X:38890020-38890042 AGGGGAGGGAACTTGGAGGATGG + Intergenic
1189486340 X:41435570-41435592 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1189594085 X:42545663-42545685 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1189636547 X:43016850-43016872 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1189739740 X:44105600-44105622 AGGGGAAGACTTTTAGATGAGGG + Intergenic
1189810193 X:44774394-44774416 AGATGAAGGAACTTACAGGAGGG - Intergenic
1189830846 X:44971764-44971786 AGATGAAGGAACTTACAGGAGGG + Intronic
1189861961 X:45281943-45281965 AGGGGAGGGAACTTAGAGGAAGG - Intergenic
1189979296 X:46492987-46493009 GTGGGAGGGAACTTAGAGGACGG + Intronic
1190448250 X:50552688-50552710 AGAGGAACAAAGTGAGAGGAGGG + Intergenic
1190530222 X:51367654-51367676 AAGGGAGGGAATTTAGAGGACGG + Intergenic
1190739137 X:53277526-53277548 TAGGGAAGAAACTTAAAAGATGG - Intronic
1190863631 X:54366501-54366523 AGGTGAGGGAACTTAGAGGACGG + Intergenic
1191074914 X:56442388-56442410 AGGGGGAGGAACTTAGAGAATGG + Intergenic
1191186587 X:57619720-57619742 AGAGGAGAGAACTTAGAGGATGG + Intergenic
1191612297 X:63130577-63130599 AGGGGAGAAAACTTAGAGGATGG - Intergenic
1191624000 X:63248349-63248371 AGGGGAGAAAACTTAGAGGATGG + Intergenic
1191807487 X:65150467-65150489 CAGGGAAGGAACTTAGAGGATGG - Intergenic
1191958227 X:66669749-66669771 AGGGGAGCGAACTTAGAGGATGG - Intergenic
1192026880 X:67462466-67462488 AGGAGAGGGAACTTAGATGATGG + Intergenic
1192327734 X:70147452-70147474 AGGGGAAGAGAGGAAGAGGATGG + Intronic
1192635416 X:72811673-72811695 AGGGGAGGCAACTTAGAGGATGG - Intronic
1192646298 X:72909130-72909152 AGGGGAGGCAACTTAGAGGATGG + Intronic
1192702283 X:73487403-73487425 AGGGGAGGGAATTTAGAGGATGG + Intergenic
1192716971 X:73653237-73653259 AGGGGAGGGAACCTAGAGGACGG + Intronic
1192874216 X:75211159-75211181 AGGGTGAGAAATTTAGAAGAGGG + Intergenic
1192997541 X:76528158-76528180 AGGGGAGGGAACTTAGAGGACGG - Intergenic
1193040685 X:77000597-77000619 AGGGGAGGGATCTTAGAGGATGG + Intergenic
1193063416 X:77231252-77231274 AGGGGAGAAATCTTAGAGTATGG + Intergenic
1193069100 X:77288798-77288820 AGGGGACAGAACTTAGAGGACGG + Intergenic
1193135478 X:77966879-77966901 AGGGGAGGAAACTTAAAGGATGG - Intronic
1193222407 X:78941921-78941943 AGGGAAAGAAGCTTGGAGGATGG - Intergenic
1193495337 X:82204317-82204339 AGGGGAGGGAACTTAAAGGATGG - Intergenic
1193555633 X:82950546-82950568 AGGGGAGAAAACTTAGACGATGG + Intergenic
1193704742 X:84807726-84807748 AGGGGAGGGAACTTAGATGACGG + Intergenic
1193767993 X:85555535-85555557 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1193780288 X:85693306-85693328 AGTGGAGGGAACTTAGAGGATGG - Intergenic
1193784751 X:85747266-85747288 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1193894238 X:87092198-87092220 AGGGTAAGAATGTGAGAGGATGG - Intergenic
1194022181 X:88704347-88704369 AGGGGAGGGAACTTAGTGGATGG + Intergenic
1194142505 X:90222703-90222725 AGGGTGAGAAATTTAGAGGAGGG + Intergenic
1194295959 X:92126755-92126777 AGGGGAAAAAATTTAAAGTATGG + Intronic
1194376184 X:93136529-93136551 AGGGGAGGGAACTTAGAAGATGG + Intergenic
1194404449 X:93477485-93477507 AGTGGAGGGAACTTAGAGTATGG + Intergenic
1194521363 X:94922087-94922109 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1194597252 X:95873616-95873638 AGGGAAGGGAACTTAGAAGATGG + Intergenic
1194706268 X:97179345-97179367 AGGGGAGGGAACCTAGATGATGG - Intronic
1194775827 X:97963133-97963155 AGGGGAGGAAACTTAGAGGATGG - Intergenic
1194783602 X:98055665-98055687 AGGAGAGGGAACTTAAAGGACGG - Intergenic
1194913538 X:99676533-99676555 AAGGGAGGGAACTTAGAGGATGG + Intergenic
1195082854 X:101387295-101387317 AGGGGAGGGATCTTAGAGGATGG - Intronic
1195101266 X:101556347-101556369 AGGAGAAGGAACCTAGATGACGG - Intergenic
1195110611 X:101645233-101645255 AGGGGAGGGATCGTAGAGGACGG + Intergenic
1195130879 X:101850670-101850692 AGGGGAGGGAACCTAGATGAAGG - Intronic
1195225767 X:102791543-102791565 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1195298788 X:103507014-103507036 AGGGGAGGGAACTTAGAGGATGG - Intronic
1195685682 X:107583215-107583237 AGGGGAGGGAACTTAGAGGACGG - Intronic
1195825764 X:108998877-108998899 AGGGGGCGGAATTTAGAGGATGG - Intergenic
1196242570 X:113360505-113360527 TGGGGAGGGAACCTAGAGGATGG - Intergenic
1196701618 X:118675591-118675613 AGGGGAGGGAACTTAGAGGATGG + Intronic
1196945622 X:120822165-120822187 AGGGGAGGGAACCTAGATGATGG + Intergenic
1197029543 X:121797275-121797297 AGGGGAGGGAACTTAGATGATGG - Intergenic
1197278084 X:124503201-124503223 AGGTGAAGGAACTTGGATGAAGG + Intronic
1197431057 X:126364229-126364251 ATGGGAGGGAACTTAGAGGATGG + Intergenic
1197618290 X:128718784-128718806 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1197680210 X:129374847-129374869 AGGGGAGGGAACTTAAAGGGTGG - Intergenic
1197866061 X:131018360-131018382 GGAGGAGGAAAATTAGAGGAGGG - Intergenic
1197913140 X:131507177-131507199 AGGGGAGGGAACTTAGAGGATGG + Intergenic
1198620981 X:138509254-138509276 AGGGGCGGGAACTTAGAGGATGG + Intergenic
1198646505 X:138812826-138812848 AGGGGAGGGAACTTAGAAGACGG - Intronic
1198848401 X:140938526-140938548 AGGGGAAAAAAATTGGGGGATGG + Intergenic
1198992002 X:142525245-142525267 AGGGAGAGAAACATACAGGAGGG + Intergenic
1199095152 X:143729334-143729356 AGGGGAGGGAACTTAGAAGATGG + Intergenic
1199125360 X:144112632-144112654 AGGGGAGGGAACTTAGAGGATGG - Intergenic
1199177238 X:144804026-144804048 AGGGGAGGCGACTTAAAGGATGG - Intergenic
1199187061 X:144927524-144927546 AGAAGAGGGAACTTAGAGGATGG + Intergenic
1199536830 X:148912260-148912282 AGGGGAGGGAACCTAGAGGATGG - Intronic
1199729874 X:150621404-150621426 AGGGGAAGAAACTGAAAGAAAGG - Intronic
1199734216 X:150669007-150669029 AGGGGAGGGAACTTAGAGGATGG - Intronic
1199931117 X:152523195-152523217 AGGGGAGGGAACCTAGATGATGG + Intergenic
1199982795 X:152929968-152929990 TGGGGAAGAAACTCAGGAGAAGG - Intronic
1200311560 X:155083879-155083901 GGGGGAAGAAACTAAGCTGAGGG + Intronic
1200320235 X:155180681-155180703 AGAGGAAGAAAGTGAGAGGGAGG + Intergenic
1200373620 X:155755879-155755901 AGGAGAAGAAAGTTAGAAGGAGG + Intergenic
1200488260 Y:3791804-3791826 AGGGTGAGAAATTTAGAGGAGGG + Intergenic
1200613463 Y:5351358-5351380 AGGGGAAAAAATTTAAAGTATGG + Intronic
1201241239 Y:11958759-11958781 AGAGGAGGGAACTTAGAGGTTGG - Intergenic
1201567092 Y:15376552-15376574 AGGGAAAGCAAACTAGAGGAGGG - Intergenic
1201739314 Y:17306526-17306548 AAGAGAGAAAACTTAGAGGATGG + Intergenic
1202085929 Y:21136785-21136807 AGGGGAGGGAACTTTGAGGATGG - Intergenic
1202141776 Y:21732074-21732096 ATGGAAAGAAACCTAGGGGAAGG + Intergenic
1202145089 Y:21771728-21771750 ATGGAAAGAAACCTAGGGGAAGG - Intergenic