ID: 917071155

View in Genome Browser
Species Human (GRCh38)
Location 1:171152326-171152348
Sequence ATATGCAAAGCACTGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 0, 2: 28, 3: 154, 4: 713}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917071152_917071155 28 Left 917071152 1:171152275-171152297 CCATTCTGTCTTTCATTCATTTT 0: 1
1: 1
2: 21
3: 560
4: 5061
Right 917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG 0: 1
1: 0
2: 28
3: 154
4: 713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917071155 Original CRISPR ATATGCAAAGCACTGTGCTA GGG Intronic
900225865 1:1533421-1533443 AGATGCCAAGCCCTGTGCTCAGG + Intronic
901193928 1:7429277-7429299 ATATGCCGTGCACTATGCTAAGG - Intronic
901541792 1:9922578-9922600 CCATGCTGAGCACTGTGCTAGGG - Intronic
901561785 1:10077534-10077556 ATGTGCTAAGCACGGTGCTGGGG - Intronic
901909061 1:12439688-12439710 ATTTGCCAGGCACTGTTCTAAGG - Intronic
902115774 1:14119885-14119907 ATGTGCCAGGCACTGTTCTAAGG + Intergenic
902500674 1:16909074-16909096 ACATGAAAACCACTATGCTAGGG + Intronic
902733698 1:18386197-18386219 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
903158732 1:21469304-21469326 ATAGGCAAAGCTCTGTTCTGGGG + Intronic
903544480 1:24115159-24115181 GTATGCCAAGCACTGTTCTCGGG - Intergenic
903640761 1:24858446-24858468 ATGTGCCAAGCACTGTTCTAAGG - Intergenic
903856432 1:26340245-26340267 GCATGCAAGGCACTGTGCTAAGG + Intronic
904052913 1:27651004-27651026 ATGTGCCAGGCCCTGTGCTAGGG + Intergenic
904383153 1:30124961-30124983 ATGTGCCAAACTCTGTGCTAAGG - Intergenic
904416209 1:30362518-30362540 GTGTGCCAGGCACTGTGCTAAGG + Intergenic
904472386 1:30744044-30744066 ATTTGCAAAGCACTGAGCTCAGG + Intronic
904802124 1:33100488-33100510 ATACTCAAAGCACCGTGCTGAGG + Intronic
904838024 1:33351621-33351643 CTGTGCAAAGCACTGTGGGAAGG - Intronic
904928736 1:34069264-34069286 ATGTACAAAGCAGTGTGCTGAGG + Intronic
904960559 1:34329466-34329488 TTGTGCCAAGCACCGTGCTAAGG - Intergenic
905034796 1:34910895-34910917 ATATGCTAAGCATTGTTCTAGGG - Intronic
905469652 1:38182260-38182282 AAGAGCCAAGCACTGTGCTAAGG - Intergenic
905588383 1:39140432-39140454 ATACGCAATACTCTGTGCTATGG - Intronic
906069574 1:43007334-43007356 AGATGCACAGCTCTGTGCCAAGG - Intergenic
906280367 1:44549288-44549310 ATATGCAAGGCATTGTGCTAGGG - Intronic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
907049349 1:51319097-51319119 ACATGCCAGGCACTGTCCTAAGG + Intronic
907790643 1:57660222-57660244 ATATTCTAAGAACTATGCTAAGG + Intronic
907806084 1:57821685-57821707 AGATGCAAAGCACTCTAATAAGG + Intronic
907944984 1:59127735-59127757 GTTTGCCAGGCACTGTGCTATGG + Intergenic
908303400 1:62784740-62784762 ATATGCAAGGCAGTGTGTTATGG - Intronic
908439282 1:64137235-64137257 ATATACAAAAGACTGGGCTAAGG - Intronic
908451761 1:64262933-64262955 GTATGCCAACCACTGTGCTGTGG - Intronic
908648888 1:66310462-66310484 ATGTGCAAAGCATTGTCCAAGGG - Intronic
908833903 1:68209433-68209455 ATGTGCTAGGCATTGTGCTAGGG + Intronic
909484688 1:76159612-76159634 ATGTGCCAAACACTGTGTTAGGG + Intronic
909876168 1:80806496-80806518 ATCTGCCAAGCAGTGTGCTAGGG + Intergenic
910258619 1:85275270-85275292 ATATGGAAAGCACTGGCCTTGGG - Intronic
910527058 1:88191899-88191921 AAATGCAAAGCTGTGTGCTGAGG + Intergenic
910566820 1:88653111-88653133 AAATGCCAGGCACTGTACTACGG - Intergenic
910788549 1:91026530-91026552 ATGTGTAAAGCTCTGTGCTCAGG - Intergenic
910903858 1:92152322-92152344 ATGTGCTAGGCACTGTTCTAAGG - Intergenic
911543990 1:99193810-99193832 ATGTACAAGGCACTCTGCTAGGG - Intergenic
911767784 1:101700208-101700230 TGATGCAAGGCACTGTTCTATGG - Intergenic
912202928 1:107479013-107479035 ATATGCAAGGCAGTGTTCCATGG - Intronic
912323527 1:108736889-108736911 ATGTGCCAGGCACTGTTCTAAGG + Intronic
912396330 1:109347042-109347064 ATATGCTAAACACTGTTCTAAGG - Intronic
912958884 1:114177425-114177447 TTATGCCAAGAACTGAGCTAAGG - Intergenic
913157516 1:116114587-116114609 TTGTGCAAAATACTGTGCTACGG + Intronic
913543501 1:119843872-119843894 ATAGGCAAAGCTCTGTTCTAGGG - Intergenic
913699839 1:121363635-121363657 ATATACAAAGTAATGTGATATGG + Intronic
914137702 1:144916401-144916423 ATATACAAAGTAATGTGATATGG - Intronic
914200333 1:145479002-145479024 ACATGAAAACCACTATGCTAGGG - Intergenic
914427508 1:147591549-147591571 ATGTGCCAAGCACTATTCTAAGG - Intronic
914479448 1:148052145-148052167 ACATGAAAACCACTATGCTAGGG - Intergenic
914506247 1:148291750-148291772 ATGTGCCAGGTACTGTGCTAAGG - Intergenic
914516907 1:148382076-148382098 ACATGAAAACCACTATGCTAGGG - Intergenic
915276723 1:154793969-154793991 ATGTGCACAGCACTGTCCCAGGG + Intronic
915622819 1:157096372-157096394 ATTTGCCAGGCACTGTCCTAGGG - Intronic
915659347 1:157389255-157389277 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
915791365 1:158675179-158675201 ATATGACAAGCACTGTCCTCTGG + Intronic
915948658 1:160172898-160172920 ATGTGCTAGGCATTGTGCTAGGG + Intronic
915990588 1:160512048-160512070 ATCTGCACAGCTCTGTGCTTGGG - Intronic
916180476 1:162078968-162078990 ATGTGCAAGGCACTGTACTCAGG - Intronic
916498129 1:165363827-165363849 TTATGCAAGGCACTGTGCTGAGG - Intergenic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
917682798 1:177384901-177384923 ATCTGCACAGCTCTGTGCTTAGG + Intergenic
917844043 1:179005550-179005572 CTGTGCCAACCACTGTGCTAGGG - Intergenic
918005117 1:180534715-180534737 ATATGCTCAGCACTGAGCAAAGG + Intergenic
918113510 1:181478527-181478549 TTATGCAAAGCAGTGCTCTAAGG - Intronic
918370969 1:183861150-183861172 ATATGCCAGGTACTGTGCTAAGG - Intronic
918592291 1:186253573-186253595 ATATTCAAGGCACTGTGGTAGGG + Intergenic
919137707 1:193531593-193531615 AGATAGAAAGCAATGTGCTAGGG + Intergenic
919231387 1:194779328-194779350 ATCTGCATAGCACTGTGCTTTGG - Intergenic
919517456 1:198544601-198544623 ATGTGCAAAGCACTGTTCCAGGG - Intergenic
920118687 1:203639334-203639356 ATATGCCAAGCACTATGTTAAGG + Intronic
920363199 1:205433538-205433560 CTATGCAAAGCCCTGTGGGAGGG - Intronic
920487252 1:206382344-206382366 ATATACAAAGTAATGTGATATGG + Intronic
920578146 1:207078430-207078452 ATTTGAGAAGCACTGTTCTAGGG + Intronic
920742471 1:208594545-208594567 CTGTGCAAGGCAGTGTGCTAGGG + Intergenic
920926730 1:210348533-210348555 ACATCCCAGGCACTGTGCTAGGG + Intronic
921475562 1:215603549-215603571 AGTTTCAAAACACTGTGCTAGGG - Intronic
921618264 1:217297464-217297486 GTTTGCCAGGCACTGTGCTAGGG + Intergenic
923013373 1:230106700-230106722 ACTTGCTAAGCTCTGTGCTAAGG + Intronic
923236847 1:232042391-232042413 GTGTGCCCAGCACTGTGCTAGGG + Intergenic
923695683 1:236248134-236248156 ATGTGCCAAGCACTGTTCTAGGG - Intronic
924535008 1:244928029-244928051 AGATTCAAAGCAGTGTTCTAAGG + Intergenic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
924623319 1:245680907-245680929 ATATGAAAAACACAGTGCTAAGG - Intronic
1062768265 10:81439-81461 ACTTTCAAAGCACTGGGCTATGG + Intergenic
1063617199 10:7610610-7610632 ATATGAAAAGCCCTTTGCTTGGG + Intronic
1063755007 10:8997674-8997696 ATATGCTCAGCACTCTGCTAGGG + Intergenic
1064105952 10:12501284-12501306 ATATTCAGAGCACTGTGCACTGG + Intronic
1064105980 10:12501522-12501544 GTATGCACGGCTCTGTGCTAGGG + Intronic
1065214472 10:23437484-23437506 ATGTGCCAAGCACGGTGTTAGGG + Intergenic
1065841751 10:29707761-29707783 ATATGCCAGGCACTGTGCTAAGG + Intronic
1065844069 10:29730225-29730247 ATGTGCAAAGAAATGTACTAAGG + Intronic
1065888415 10:30099506-30099528 ATGTTCCAGGCACTGTGCTAGGG + Intronic
1066584420 10:36916756-36916778 ATGTGCAAGACACTGTGCTAGGG + Intergenic
1067158531 10:43802909-43802931 ATATGCAAAGCAGCAGGCTAGGG - Intergenic
1068047336 10:51903979-51904001 ATTTGCCAGGCACTGAGCTAAGG - Intronic
1068429242 10:56911042-56911064 ATATGCCAAACCCTTTGCTAAGG + Intergenic
1068440065 10:57041751-57041773 AAATGCAAAGTAGTGTGCAAGGG + Intergenic
1068581702 10:58748212-58748234 ATATGCCAGGCAGTGTTCTAGGG + Intronic
1068655409 10:59569769-59569791 ATGTGCCAAGCACTGCTCTAGGG - Intergenic
1068661663 10:59628959-59628981 AAGTGCCAAGCTCTGTGCTAAGG + Intergenic
1068797673 10:61102041-61102063 ATATGAGAACCACTGTCCTACGG + Intergenic
1068990777 10:63148114-63148136 ATATGTTAGGCACTGAGCTATGG + Intronic
1069017040 10:63441990-63442012 ATTTGTAAAGCACTGTTCTGTGG + Intronic
1070341261 10:75500306-75500328 AGATGCAAAGCACTTAGCGAAGG - Intronic
1070560275 10:77561184-77561206 ATTTGTCAAGCATTGTGCTATGG + Intronic
1070638243 10:78146432-78146454 AAATGTAAAGCACAGTGCTTGGG - Intergenic
1070759926 10:79017711-79017733 AAGTGCAAAGCATTGTGCAAAGG - Intergenic
1071325841 10:84516372-84516394 ATCAGCAAAGCACTTTGTTATGG + Exonic
1071393434 10:85198133-85198155 ATATTCCAAGCACTGTGCAAGGG - Intergenic
1071424285 10:85532852-85532874 ATATCCTAAGCACTGAGCTTAGG - Intergenic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1072695377 10:97599473-97599495 ATATGCCACGCACAGTTCTAAGG - Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1073029672 10:100515601-100515623 ACATGCCAGACACTGTGCTAGGG - Intronic
1074692412 10:116018334-116018356 ATGTGCCCAGCACTGTGCTGTGG + Intergenic
1075339489 10:121634414-121634436 ATATGCAAAACAGTGTGGTATGG + Intergenic
1075392338 10:122101377-122101399 ATGTGCAGCCCACTGTGCTAAGG - Intronic
1075428716 10:122363188-122363210 ATATCCAAAGCACTGTCTTTTGG + Intergenic
1075468413 10:122669858-122669880 ATATGCAAAACATTATGCTTGGG - Intergenic
1075539775 10:123302397-123302419 TTGTGCCAGGCACTGTGCTAAGG - Intergenic
1075860896 10:125675485-125675507 ATCTGCACAGCTCTGTGCTTGGG + Intronic
1075981545 10:126744773-126744795 ACATGTCAAGCACTGTTCTAAGG - Intergenic
1076011447 10:126992439-126992461 ATATGCAGAGCGCTGGGCTTTGG - Intronic
1076027242 10:127126046-127126068 AAAAGCAAAGCACTGACCTAGGG - Intronic
1077901112 11:6489542-6489564 ATATGCCAAGCACTGTGATAAGG - Intronic
1078090974 11:8264391-8264413 ATGTGCCAAGCACAGTTCTAAGG + Intronic
1078094322 11:8287352-8287374 ACATGCCAAGCACTGTCCTAGGG - Intergenic
1078344442 11:10532980-10533002 ATGTGCAAGGCCCTCTGCTAAGG - Intronic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078740993 11:14066123-14066145 AAATGCTAAGTAATGTGCTAAGG + Intronic
1078871389 11:15348431-15348453 ACTTGAGAAGCACTGTGCTAGGG + Intergenic
1078901766 11:15649219-15649241 ATGTGCCAAGCACTGTGCCCTGG - Intergenic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1079025014 11:16940183-16940205 ATGTGCCAGCCACTGTGCTAGGG - Intronic
1079331275 11:19534996-19535018 ATGTCCCAGGCACTGTGCTAAGG - Intronic
1079335811 11:19569624-19569646 ATGTACCAAGCTCTGTGCTATGG - Intronic
1079588096 11:22150298-22150320 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
1079836979 11:25347823-25347845 ATTTGCAAAGGACTGTTTTATGG + Intergenic
1079976811 11:27102172-27102194 AAAAGCAAAGTACAGTGCTAAGG + Intronic
1080494229 11:32799962-32799984 ATGTGCCAAGCACTGCGCTGAGG - Intergenic
1080758926 11:35228992-35229014 GTGTGCCAAGCACTGTGCTAGGG - Intronic
1081792354 11:45797208-45797230 GTGTGCAAGGTACTGTGCTAGGG + Intergenic
1082928048 11:58571743-58571765 ACATGCCAGGCACTGTGCTCAGG + Intronic
1083091535 11:60204339-60204361 AGATGCAAAGGATTTTGCTAGGG + Intronic
1083146854 11:60766453-60766475 CTATGCTAAGCACTGTGCTGGGG - Intronic
1083207242 11:61160059-61160081 ATATGCTGGGCACTGTTCTAGGG - Intronic
1083530987 11:63421692-63421714 ACATTCAAAGCAGTGTGCTGAGG + Intergenic
1083778698 11:64907047-64907069 GTATGTAAAGCACCATGCTAGGG - Intronic
1084051342 11:66602109-66602131 ATAAGCATGGCACTGTGCAATGG - Intronic
1085029777 11:73264137-73264159 ATGTGCCAAGCACTGTGCTAAGG - Intergenic
1085043273 11:73339234-73339256 AGATGCCAAGCACTGTGCTGGGG - Intronic
1085089092 11:73694453-73694475 ATATGGAAAGCACTGTGAAAGGG + Intronic
1085210468 11:74772410-74772432 AAGTGCCAAGTACTGTGCTAGGG - Intronic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085826794 11:79856605-79856627 ATTTACCAAGCACTGTGCTAAGG - Intergenic
1085903541 11:80731528-80731550 ATGTGCAAGGCACTGTCCTAGGG - Intergenic
1085998108 11:81947070-81947092 ATATGCAAAGCATTGTTCCTGGG + Intergenic
1086270001 11:85051486-85051508 ACGTGCCAAGCACTATGCTAAGG + Intronic
1086312720 11:85553292-85553314 ATATGCCAAACACTGTTTTAAGG + Intronic
1086464171 11:87036929-87036951 ATTTACCAGGCACTGTGCTAAGG - Intergenic
1086961810 11:92985600-92985622 ATATGCCAGGCACTGTTCTAAGG + Intergenic
1087558201 11:99749424-99749446 ATGTGCCAAGCATTGTTCTAAGG - Intronic
1087693334 11:101347362-101347384 GTGTACCAAGCACTGTGCTAGGG + Intergenic
1087755332 11:102048682-102048704 TTATTCAAATCACTGTGCTACGG - Intronic
1088684553 11:112273961-112273983 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1089181585 11:116586984-116587006 ATGTGCCAGGAACTGTGCTAAGG - Intergenic
1089701689 11:120248435-120248457 ATGTGCCAAGCACTGTGCTAAGG - Intronic
1089918688 11:122185712-122185734 CTATGCTAAGCACTATTCTAGGG - Intergenic
1089998099 11:122928093-122928115 TTGGGCAAAGCACTGTGGTAGGG - Intronic
1090050588 11:123375044-123375066 ATGTGCCAAACACTTTGCTAAGG + Intergenic
1091280572 11:134379609-134379631 ATTTCCAAAGCAGTGTGCTCAGG + Intronic
1091970774 12:4785093-4785115 ATGTGCAGAGAGCTGTGCTAGGG - Intronic
1092152142 12:6256673-6256695 CTGTGCCAAGCACTGTTCTAAGG + Intergenic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1092648311 12:10604103-10604125 ATATGGAAAAGACTGTGCTAGGG + Intergenic
1093348155 12:18065850-18065872 ATGTGCCAGACACTGTGCTAAGG + Intergenic
1093625413 12:21340980-21341002 ATATTCCAAGCACTGTTCTAGGG + Intronic
1095675512 12:44913021-44913043 GTATGCCAAGCACTTTTCTAAGG - Intronic
1095801512 12:46273889-46273911 ATATACCAAGCATTGTGCTTAGG - Intergenic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096427906 12:51519960-51519982 ATATGCAAAGCACAGTGGTGAGG + Intergenic
1096513143 12:52142953-52142975 ATGTGCTAGGCACTTTGCTAAGG - Intergenic
1096610473 12:52797629-52797651 ATTGGCAAAGCACTGTGCTTTGG - Intergenic
1096765441 12:53884902-53884924 ATGTGCCATGCATTGTGCTAAGG - Intergenic
1097283807 12:57862588-57862610 ATATGCCAGGCACTGTGAAAGGG + Intergenic
1097400478 12:59122474-59122496 ATGTGCAAGGCACTGTGCCCAGG - Intergenic
1097582625 12:61476743-61476765 AAATGCAGAGCACAGTGCTCTGG + Intergenic
1097636639 12:62130625-62130647 ATGTGGCAGGCACTGTGCTAGGG + Intronic
1097900435 12:64867625-64867647 ATATGCCAGGGTCTGTGCTAAGG - Intronic
1098324544 12:69287996-69288018 AGATGTCAGGCACTGTGCTAGGG + Intergenic
1098551280 12:71764031-71764053 ATGTGCCAAGCACTGTGCTTGGG - Intronic
1099346177 12:81502643-81502665 ATGTGCTAGGAACTGTGCTAGGG + Intronic
1099705246 12:86143984-86144006 ATGTGCTAGGCACTGTGCTAGGG - Intronic
1100116818 12:91315733-91315755 ATGGGCAAAGAACTTTGCTATGG - Intergenic
1100233122 12:92630409-92630431 ATATGCCAGGCACTGAGCTATGG + Intergenic
1100461745 12:94806620-94806642 GTGTGCCAAGCACTGTGCTAAGG - Intergenic
1100462497 12:94815096-94815118 ATGTGCCAAGCACTGGGATATGG + Intergenic
1100527724 12:95435665-95435687 ATATGCCAAGCACTGTTTTTGGG + Intergenic
1100725347 12:97402766-97402788 ATGTGCCAAGCTTTGTGCTAGGG - Intergenic
1101486099 12:105162472-105162494 ATATACAAGGCACTGTTCTTGGG + Intronic
1101554500 12:105795665-105795687 ATATGCCAGGCACCATGCTAAGG - Intergenic
1101657073 12:106731932-106731954 TTATGCCAAGCACTAGGCTAAGG + Intronic
1102328114 12:112006570-112006592 TTGTGCAAAGCAGTGTGTTATGG + Intronic
1102522642 12:113488284-113488306 ATGTGCTAGGCACTCTGCTAGGG + Intergenic
1104512939 12:129398072-129398094 GTTTGCTAAGCACTGTGCTGAGG + Intronic
1105059806 12:133138790-133138812 ATATGCCAAGTACTATCCTAGGG - Intronic
1105671170 13:22618036-22618058 ATAAGCAAAGAAGTGTGCTGGGG + Intergenic
1105882224 13:24615003-24615025 GTCTGCAAAGCGCTGTGCTTGGG - Intergenic
1106300917 13:28464544-28464566 ATGTGCAAGGCACTGTACCAGGG + Intronic
1106322555 13:28655767-28655789 GTATGCAAGGCACTGTGCTGTGG + Intergenic
1106669982 13:31894622-31894644 TTAAGCTAAGCACTGTGTTAGGG + Intergenic
1106698558 13:32204821-32204843 ACATGCTAGGCACTGTGCTTGGG + Intronic
1107285995 13:38792748-38792770 TTATGCAAAGCACTTTGATTTGG + Intronic
1107652461 13:42559148-42559170 ATATATTAAGCACTGTTCTAAGG + Intergenic
1109715819 13:66220493-66220515 ATGTGCCAAGCAATGTGCTAAGG + Intergenic
1110010309 13:70324959-70324981 ATATGCAAAGCTGTATTCTAAGG + Intergenic
1110155520 13:72312171-72312193 ATATGCCAGGCACTATGCTATGG + Intergenic
1110175435 13:72550321-72550343 ATTTAGAAAGCTCTGTGCTATGG - Intergenic
1110328789 13:74247912-74247934 ATCTCCCAAGCACTGTGCAAAGG + Intergenic
1110984421 13:81946097-81946119 AGATGCAAAGCATTGTTCTTCGG + Intergenic
1111760676 13:92460466-92460488 ATATGCTAAGCATTTTGCCATGG + Intronic
1111975734 13:94965468-94965490 ATATGCAAAACTCTCTGGTAAGG - Intergenic
1113241083 13:108337892-108337914 GTAAGTAAAACACTGTGCTAAGG - Intergenic
1113543039 13:111123703-111123725 GTATGCCAGGCACTGTTCTAAGG + Intronic
1114699247 14:24660573-24660595 TTATGCAAAACCCTTTGCTAGGG - Intergenic
1115114976 14:29869680-29869702 GTGTGCCAAGCACTATGCTATGG + Intronic
1115117487 14:29899771-29899793 ATGTGCAAAGCACTATGATATGG + Intronic
1115168086 14:30472117-30472139 ATCTTCAAAACAGTGTGCTAAGG + Intergenic
1115410444 14:33068083-33068105 CTATGCAAAGCACCATGCTAGGG + Intronic
1115519240 14:34216520-34216542 ATATGCCAGGCCCTGTGCAAAGG + Intronic
1115716424 14:36110107-36110129 ATAAGCAAAGCCCTTTTCTAGGG - Intergenic
1115970726 14:38941989-38942011 ACATGCAAAGCTCTGTCTTATGG - Intergenic
1116392648 14:44412184-44412206 ATATGCCAGGCACTGAGCCATGG + Intergenic
1116428598 14:44820360-44820382 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1116827477 14:49686683-49686705 AGCTGCAAAGCACCGTGCTGGGG - Intronic
1117127020 14:52640089-52640111 ATATGCCAAAAACTATGCTATGG + Exonic
1117750995 14:58923922-58923944 ATCTGCACAGCCCTGTGCTTGGG - Intergenic
1118055556 14:62076127-62076149 ATATGCCAGGCACTGTGATAAGG + Intronic
1118060406 14:62131801-62131823 ATGAGCCAGGCACTGTGCTAGGG + Intergenic
1118089183 14:62453748-62453770 ATATGCATAGCATTCTGCTGGGG + Intergenic
1118608789 14:67523427-67523449 ATGTGCCATGCACTGTGCTAAGG + Intronic
1118822968 14:69357033-69357055 ACATGCCAAACACTTTGCTAGGG + Exonic
1119068374 14:71553876-71553898 TTATACAAAACACTATGCTAAGG - Intronic
1119497612 14:75093910-75093932 ATTTGCCAGGCACTGTTCTAGGG + Intronic
1120633133 14:86915852-86915874 AAATGCAAAGCACAGTGTTTAGG + Intronic
1120947269 14:90010358-90010380 ATATGAAAAGCACTGTGTGGTGG + Intronic
1121309275 14:92926394-92926416 ACATGGTAAGCACTGTGTTAAGG + Intronic
1121412665 14:93758781-93758803 ATGAGCAAAGCATTGTGCAATGG + Intronic
1121425915 14:93851967-93851989 GTGTGTCAAGCACTGTGCTAGGG - Intergenic
1121688562 14:95857906-95857928 GTATGCCAAGCTCTGTGCTAGGG + Intergenic
1121805801 14:96821205-96821227 ATGTGCCAGGAACTGTGCTAGGG - Intronic
1121867258 14:97374166-97374188 CTATGGTAAGCACTGGGCTAGGG - Intergenic
1121868354 14:97384001-97384023 CTATGCAAAGCCATGTGCTATGG + Intergenic
1124854883 15:33378119-33378141 CTATGCCAAGCATTATGCTAAGG - Intronic
1124859429 15:33424312-33424334 ATGTGCCAAGCAATGTACTAAGG - Intronic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1125183303 15:36902122-36902144 ATGTGCCAGGCATTGTGCTAAGG - Intronic
1125285162 15:38084699-38084721 ATATGCCAAGGTTTGTGCTAGGG - Intergenic
1125695447 15:41633279-41633301 ATATGCCAGGCATTGTGTTAAGG + Intronic
1125786998 15:42327964-42327986 GTGTGCCAAGCACTGTGCTAAGG + Intronic
1125914325 15:43472277-43472299 ATAGGCAAGGCATTGTTCTAAGG - Intronic
1126216555 15:46161836-46161858 ATATGCAAATCAATGTGATAAGG + Intergenic
1126376878 15:48005876-48005898 GTGTGCCAGGCACTGTGCTAGGG - Intergenic
1126380142 15:48038135-48038157 ATATGCCAAGCACTGTTCTAAGG + Intergenic
1126439040 15:48667556-48667578 CTTTGCAAAGCACTGCTCTATGG + Intergenic
1126451405 15:48812709-48812731 ATCTGTAAAGCACTGTGTAATGG - Intergenic
1126541784 15:49831950-49831972 GTATGCCAGCCACTGTGCTAAGG + Intergenic
1126627347 15:50697741-50697763 ATATGCCAGCCACTGTACTAAGG - Intergenic
1126691208 15:51290164-51290186 ATATGCCAGGCACTGTGCAAAGG - Intronic
1127319060 15:57825104-57825126 ATATGCCTAGAACTGTGCTGGGG - Intergenic
1127568560 15:60217367-60217389 ATGTGCCAGGCACTTTGCTAAGG - Intergenic
1128645556 15:69376381-69376403 CTATGCAAAACACTTTGCTAAGG + Intronic
1128844297 15:70876339-70876361 CTGTGCCAAGCACTGTTCTAAGG - Intronic
1128990500 15:72255750-72255772 ATATGTAAAGTACTGTTTTAGGG - Intronic
1129337765 15:74863734-74863756 CCATGCCAAGCACTGGGCTAGGG + Intronic
1129857977 15:78838406-78838428 ACAGGCAAAGCACTGTGCCGGGG - Intronic
1130150756 15:81309776-81309798 ACATGCCAAGCACTGTGCTCAGG + Exonic
1130516267 15:84628284-84628306 ATGCGCCAGGCACTGTGCTAAGG + Intergenic
1130521547 15:84665172-84665194 ATATGCAAAGCACTGCAATAGGG + Intergenic
1130569080 15:85024299-85024321 ATATGCCAGGTACTGTGCCAGGG - Intronic
1130857732 15:87856024-87856046 ATTTGCCAAGCTCTCTGCTAAGG - Intergenic
1130925060 15:88379160-88379182 ACTTGCCAGGCACTGTGCTATGG - Intergenic
1130969708 15:88722275-88722297 ACATGCCAAGCACTGTGCTAAGG - Intergenic
1131190021 15:90307361-90307383 GTCTGCTAAGCACTGTGCTAAGG + Intronic
1131700242 15:94927763-94927785 ATAGGCCAAGCACTTTGCTGTGG + Intergenic
1131714095 15:95089844-95089866 ATATTCAAAACAATTTGCTACGG + Intergenic
1131771919 15:95747031-95747053 ACATTCCAAGCACTGTGCTCAGG - Intergenic
1131889157 15:96953275-96953297 ATGTGCAAGTCACTGAGCTAAGG + Intergenic
1133386671 16:5375664-5375686 ATGTGCCAGGCACTGTGCCAGGG + Intergenic
1133458300 16:5962639-5962661 ATATGTAAAGCACTGAGAAATGG + Intergenic
1133510507 16:6452891-6452913 AGGTGCAAAGCTGTGTGCTAAGG - Intronic
1133976127 16:10600937-10600959 ATTTGAAAAACACTGAGCTAAGG - Intergenic
1134133059 16:11662783-11662805 ATGTTCCAAGCACTGTGCTAGGG - Intergenic
1134555675 16:15161945-15161967 ATATGCCAGGTCCTGTGCTATGG + Intergenic
1134568397 16:15270696-15270718 GTATGCCAAGCACAGTGCCAAGG + Intergenic
1134614689 16:15642343-15642365 ATATGCCAGGCATTGTACTAAGG - Intronic
1134734031 16:16485664-16485686 GTATGCCAAGCACAGTGCCAAGG - Intergenic
1134916257 16:18073656-18073678 ATATGCCAGGTTCTGTGCTATGG + Intergenic
1134933467 16:18226617-18226639 GTATGCCAAGCACAGTGCCAAGG + Intergenic
1135195025 16:20387115-20387137 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1135657967 16:24268025-24268047 AGATGCCAGGCACTGTTCTAAGG + Intronic
1135660214 16:24289867-24289889 ATATTCTTAGCACTGTTCTAGGG - Intronic
1137476503 16:48814081-48814103 TTGTGCTAGGCACTGTGCTAGGG + Intergenic
1138777507 16:59741654-59741676 TTATGCAAACCACTGTATTATGG + Intronic
1138882379 16:61031446-61031468 TTCTGCACAGCACTGTGCTTGGG + Intergenic
1139124076 16:64056370-64056392 GGATCCCAAGCACTGTGCTATGG - Intergenic
1139254433 16:65527648-65527670 ACATACAAAGCACTGTTCTGTGG - Intergenic
1139294602 16:65889432-65889454 ATGTGCTAGGCACTGTGTTAGGG - Intergenic
1139359747 16:66390160-66390182 GTATGCCAGGCACTTTGCTAGGG - Intronic
1139612407 16:68068545-68068567 ACATGCCAGGCACTGTGCCAAGG - Intronic
1139682611 16:68576809-68576831 ACATGCATAGCGCTGTGCAAGGG + Intergenic
1139997958 16:70998183-70998205 TTGTGCAGGGCACTGTGCTAGGG - Intronic
1140016628 16:71193044-71193066 ATATGCAAAGGACAGAGTTATGG - Intronic
1140133994 16:72189097-72189119 ATGTGCCAGGCACCGTGCTATGG + Intergenic
1140520114 16:75573702-75573724 GTATGAGAAGCACTGTTCTAAGG + Intronic
1140574169 16:76145420-76145442 AAATGAAAATCACTGTGATATGG - Intergenic
1141513530 16:84527766-84527788 ATGTGCCAAGCACTATTCTAAGG + Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1143288136 17:5807145-5807167 ATTTGAAAAGCACTGTTCAAAGG - Intronic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1144049505 17:11486477-11486499 ATATGCAAAGTACTATGCTAAGG + Intronic
1144251627 17:13422366-13422388 ATATGCCAGGCACTGTACCAAGG + Intergenic
1144863567 17:18320738-18320760 ATAGGGACAGCACTGGGCTATGG - Intronic
1146475739 17:33161250-33161272 GTATGCCAGGCAGTGTGCTAAGG + Intronic
1147639572 17:41987470-41987492 ATGTGTCAAGCACTGTGCCAGGG + Intronic
1148393241 17:47288733-47288755 CTATGCAAGGCACTGGGCCAGGG + Intronic
1148689495 17:49518947-49518969 ATATGCCAGGCAAGGTGCTAAGG - Intergenic
1148995450 17:51705469-51705491 ATGTGCCAAGCACTGTTTTAGGG - Intronic
1149187031 17:54010451-54010473 ATATGCTACGCACTTTTCTAGGG - Intergenic
1149256210 17:54829839-54829861 ATGTGCAAAGCACTGCATTAGGG + Intergenic
1149418532 17:56485780-56485802 ATTTGAGAAGCACTGTTCTAGGG - Intronic
1149608985 17:57945668-57945690 ATATGCAAAACATTGTGCTAGGG + Intronic
1149620134 17:58038189-58038211 CTGTGCCAAGCATTGTGCTAAGG + Intergenic
1149689230 17:58560157-58560179 ATGTCCAAAGCACTGTGCTAGGG - Intronic
1149785523 17:59431480-59431502 ATGTGGAAGGCACTGTGCTCAGG - Intergenic
1150050721 17:61959512-61959534 AGATACGAAGCACTGTTCTAAGG + Intronic
1150147293 17:62779631-62779653 GTATGCAAAGCATTGTGCTATGG + Intronic
1150190543 17:63233302-63233324 ATCTGCACAGCTCTGTGCTTGGG + Intronic
1150333343 17:64312066-64312088 GTGTGCAAAGCACTGTGGGAAGG + Intergenic
1150494838 17:65599375-65599397 ATGTGCTGGGCACTGTGCTAAGG + Intronic
1150843353 17:68630204-68630226 ATGTGCTAAGCTCTGTGCTAAGG - Intergenic
1151134241 17:71930376-71930398 TTATGCATAGCAATGTGCAAAGG + Intergenic
1151489764 17:74425974-74425996 ATGTATAAAGCACTGTGCTAGGG + Intronic
1151777008 17:76211578-76211600 ATGTTCTAAGCACTGTTCTAAGG - Intronic
1151887954 17:76934192-76934214 ATGTGCCAGGCATTGTGCTAAGG + Intronic
1152481007 17:80552560-80552582 ATGTGCCAAGCACTGCCCTATGG - Intronic
1152961152 18:81294-81316 ACTTTCAAAGCACTGGGCTAAGG + Intergenic
1152987877 18:336050-336072 ATATGACAAGCACCGTGTTAAGG + Intronic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1153203832 18:2675168-2675190 ATATGCGAGGCTCTGTCCTAAGG - Intronic
1153328011 18:3841692-3841714 TCCTGCAAAGTACTGTGCTAAGG - Intronic
1153484740 18:5585687-5585709 CTTTGCTAGGCACTGTGCTATGG + Intronic
1153809804 18:8742042-8742064 AAAAAAAAAGCACTGTGCTATGG + Intronic
1154184884 18:12174448-12174470 AAATGAAAATCACTGAGCTACGG - Intergenic
1154282136 18:13013538-13013560 CTCTGCAAATCACTGTGCCAAGG + Intronic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1155304005 18:24461098-24461120 ATATGTAAATCAGTGTGGTAGGG + Intronic
1156385539 18:36601517-36601539 ATATGCCAGGCACTGTCCTAAGG + Intronic
1156873039 18:41970137-41970159 ATGTGCAAAGCAGTGTGACATGG + Intronic
1157318923 18:46619534-46619556 ACATGCCCAGCACTGTGCTAGGG - Intronic
1157714288 18:49872491-49872513 ATATGTATAGCACTGTGTTATGG + Intronic
1157797755 18:50590858-50590880 ATATGCTGAGCTCTGTGCTTTGG - Intronic
1157828189 18:50831443-50831465 ATGTGCCAAGTACTGTGCTGGGG - Intergenic
1157837072 18:50914511-50914533 TTATGCAATGCATTGTGCTATGG + Intronic
1158260188 18:55597949-55597971 CTATGAAAAGCACTATGCAAGGG + Intronic
1158677022 18:59529446-59529468 ATCTGCACAGCTCTGTGCTTGGG + Intronic
1158694157 18:59688529-59688551 ATATGCAAATCAATGAGGTAAGG + Intronic
1158908601 18:62037893-62037915 ATATGCCAAGCCCTGTGCCAGGG - Intergenic
1159433696 18:68387379-68387401 ATATGCAAAGCACTCTGTGGAGG - Intergenic
1159848968 18:73503136-73503158 ATATGTGAAGCCCTGGGCTAGGG + Intergenic
1160048990 18:75414340-75414362 ACATGCCAAGTACTGTGCTAGGG + Intronic
1161609483 19:5233433-5233455 ATGTGCCAGGCACTGTGCCAAGG + Intronic
1161758776 19:6155025-6155047 ATTTGCTAAGCACTGTGCTAAGG - Intronic
1162104205 19:8360348-8360370 ATATGCCAGGCACTGTACTGGGG - Intronic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1165145818 19:33729350-33729372 CTATGCCATGAACTGTGCTACGG - Intronic
1166026356 19:40089488-40089510 ATATGCCTAGCACTGCTCTAAGG + Intronic
1166543376 19:43620017-43620039 ATATGCTAATCACTGCGCTCTGG - Intergenic
1166667620 19:44690434-44690456 ATACGCCATGCACTATGCTAAGG + Intergenic
1167851597 19:52206457-52206479 AAGTGCCAAGTACTGTGCTAGGG - Intronic
925129386 2:1483631-1483653 TGGTGCCAAGCACTGTGCTATGG - Intronic
925801916 2:7609954-7609976 ATGTGCCAGACACTGTGCTAGGG - Intergenic
926079079 2:9969263-9969285 ATATGCTAGGTGCTGTGCTAAGG + Intronic
926240384 2:11080769-11080791 ATGTGCTAAGCACTGTGCTCAGG + Intergenic
926397373 2:12457490-12457512 ATAAGCAAAGCACAGTCCTAGGG + Intergenic
926520238 2:13901308-13901330 ATATTCAATGCAGTGTACTAGGG + Intergenic
926947597 2:18204632-18204654 GTGTGCCAACCACTGTGCTAGGG - Intronic
927271625 2:21216345-21216367 TTTTGCCAGGCACTGTGCTAAGG + Intergenic
927710718 2:25324216-25324238 ATGTGCCAAGCACTGTGCTAAGG + Intronic
927904221 2:26846039-26846061 CTATGCCAGGCAATGTGCTATGG + Intergenic
928008715 2:27586792-27586814 ATATGCAAACCACTGTACAGTGG - Intronic
928082050 2:28320316-28320338 ATGTGCAGAGCACCATGCTAAGG + Intronic
928200647 2:29245786-29245808 ATGTGCAGGGCACTGAGCTATGG - Intronic
928259866 2:29756843-29756865 ATGTGCCAGTCACTGTGCTAGGG + Intronic
928275152 2:29893966-29893988 ATGTGCCAAGCACTCTGCTAAGG - Intronic
928784605 2:34867476-34867498 ATATGGAAACCTCTGTGATATGG + Intergenic
929080830 2:38120524-38120546 ATGTATAAAGCACTGTGCCAGGG - Intergenic
929093411 2:38241660-38241682 ACATGCCAGGCACTATGCTAAGG + Intergenic
929165020 2:38873555-38873577 ATATGCTAGACACTGTGTTAAGG - Intronic
929298787 2:40277854-40277876 ATGTGCAGGGCACTGTCCTAAGG + Intronic
929832126 2:45355617-45355639 ATGTGCTAAGCACTGTGCCAGGG + Intergenic
930490039 2:52057992-52058014 ATGTGCCAAGCTCTTTGCTAAGG - Intergenic
931576619 2:63723548-63723570 ATGTGCAAAGCATTGTGTGAGGG - Intronic
931604072 2:64034240-64034262 ATGTGCAAATCACTATACTAAGG - Intergenic
931719649 2:65057615-65057637 ATGTTCCAAGCATTGTGCTAGGG - Intronic
932060828 2:68495922-68495944 ATATGGATAGCACTGTCCCAAGG + Intronic
932123354 2:69121233-69121255 ATGTGCCAAGCAATGTGCTAAGG - Intronic
932187494 2:69711406-69711428 ATCTCAAAAGCAGTGTGCTAAGG + Intronic
933119673 2:78521249-78521271 CTATGGTAAGCATTGTGCTATGG + Intergenic
934094196 2:88584152-88584174 ATGTGCCAAGCACTGTGTAAGGG + Intronic
935952688 2:108345322-108345344 ATCTGCATAGCTCTGTGCTTGGG + Intergenic
936105426 2:109620126-109620148 ACATGCCAGGCACTGTGCAAGGG - Intergenic
936797838 2:116228406-116228428 ATATGCCAGGAACTGTGCTGGGG + Intergenic
937140882 2:119599185-119599207 ATTTCTAAAGCACTGTGCTGGGG + Intronic
937463929 2:122112659-122112681 CTGAGCCAAGCACTGTGCTAGGG - Intergenic
937533194 2:122854646-122854668 ATGTGCTTAGCACTGTTCTAAGG + Intergenic
937680557 2:124640078-124640100 GTATGCAGAGCACTATGTTAGGG - Intronic
938164282 2:129012304-129012326 ATGTGCAAGGCACTGTTCAAAGG - Intergenic
938226477 2:129620740-129620762 ACATGCAAAATACTGTTCTATGG - Intergenic
939504934 2:143033516-143033538 ATGTGCCAAGCATTGTGCTGGGG - Intronic
939892571 2:147755116-147755138 ATAGGCAGATCACTGTGATATGG + Intergenic
939953663 2:148505974-148505996 ATGTGCCAAGTACTGTGCTGAGG - Intronic
941036611 2:160575727-160575749 ATGTGCTAAGGACTATGCTAAGG + Intergenic
941310016 2:163915703-163915725 ATATGCCAGGCAATGTGCTGAGG - Intergenic
941441543 2:165543861-165543883 ATATGCAAAGCACTTTTCTAGGG + Intronic
941496684 2:166213929-166213951 AAATGTAAGGCACTGTGCTCAGG - Intronic
942081424 2:172402861-172402883 ATATGCCAGGCATTGTACTATGG - Intergenic
942086231 2:172446523-172446545 ATGTGCCGAGCACTGTGCAAAGG + Intronic
942156599 2:173135015-173135037 ATATGCCAAGCATTGTCCTGAGG - Intronic
942828087 2:180204780-180204802 ATATGCTAGGCACTGTTCTAGGG + Intergenic
943288889 2:186042828-186042850 AGCTGAAAAGCACTGTGCTGGGG + Intergenic
943797201 2:192011337-192011359 CTGTGCAAAACACTGTGCTAGGG + Intronic
944035471 2:195290185-195290207 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
944118742 2:196217460-196217482 CTATGCCAAGCACTGTACCAAGG + Intronic
944162154 2:196674882-196674904 ATATACTAAGCATTGTGCTAAGG + Intronic
944409356 2:199422787-199422809 ATATACCAGGCACTGTCCTAGGG - Intronic
945406856 2:209459318-209459340 ATGTGCCAGGCACTGTTCTAGGG - Intronic
945740708 2:213657354-213657376 ATGTGTCAAGCACTCTGCTAAGG - Intronic
945920579 2:215750962-215750984 ATGTGCCAAGCACTCTTCTAAGG - Intergenic
946728729 2:222688145-222688167 ATATGCCAAGCATCGTGTTATGG - Intronic
946957362 2:224945760-224945782 ATATGAAAACCACAGTTCTAGGG - Intronic
947251548 2:228111363-228111385 ATATGTGAAACACTGTGCCATGG + Intronic
947373454 2:229471723-229471745 ATTTGCAAAGCACAGTGCTAAGG + Intronic
947395618 2:229683943-229683965 CTGTGCAGAGCACTGTGTTAGGG + Intronic
947552982 2:231060618-231060640 ATATGGAGAACACTGTGCTTGGG + Intronic
948030348 2:234812765-234812787 ATATGCCAGGCACATTGCTAGGG + Intergenic
1169519006 20:6351180-6351202 ATATGCAAAGCAGTGAGTTAAGG + Intergenic
1169997597 20:11576120-11576142 TTATAGCAAGCACTGTGCTAGGG - Intergenic
1170879926 20:20287970-20287992 ATATGCCAGGCACTGTGTGAGGG - Intronic
1172582034 20:36055969-36055991 ATATGCAAGGCACTGTACTGAGG + Intergenic
1172624912 20:36341418-36341440 ACATGCCAGGCACTTTGCTAGGG - Intronic
1172626052 20:36347480-36347502 ATGTGCCAAGCCCTGTGCTGGGG + Intronic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1173670448 20:44795157-44795179 ATGTACCACGCACTGTGCTAAGG + Intronic
1173846153 20:46189995-46190017 GTTTGCAAACCACTATGCTAGGG + Intronic
1174224470 20:48985736-48985758 GTGTGCCAGGCACTGTGCTAAGG + Intronic
1174519702 20:51120008-51120030 ATATGCCAGGCACTGTTCCAAGG + Intergenic
1174523511 20:51153529-51153551 ATGTGCCAAGCACTGTGCTGAGG + Intergenic
1174634521 20:51987539-51987561 ATGTGCCAGGCACTGTTCTATGG + Intergenic
1174663648 20:52237248-52237270 GCATGCCAAGCACTGTGCCAAGG - Intergenic
1174774095 20:53327654-53327676 ATGTGACAAGCACTGAGCTAGGG + Intronic
1174886800 20:54344647-54344669 ATATGCCAAGTACTATGCAAAGG - Intergenic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1175078372 20:56395289-56395311 GTATGCCAGGCACTGTGCTCAGG + Intronic
1175154316 20:56959382-56959404 ACATGTAAAGGATTGTGCTATGG + Intergenic
1175373479 20:58508714-58508736 ATGTGCCAGGCACTGTTCTAGGG + Intronic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1175715001 20:61249507-61249529 ATGTGCCAAACACTGTGCCAGGG + Intergenic
1176903379 21:14470530-14470552 ATAAGTAAAGCACTGGGCAATGG - Intergenic
1177115936 21:17087416-17087438 ATAAACAAGGCACTGGGCTAAGG - Intergenic
1177388059 21:20433066-20433088 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1177581464 21:23028190-23028212 ATATTCCAGGCACTGTTCTAAGG - Intergenic
1177876685 21:26641871-26641893 ATGTGCAGAAAACTGTGCTATGG + Intergenic
1177906282 21:26974675-26974697 ATATGCAAAGGACTGAGCTAGGG - Intergenic
1178347127 21:31839750-31839772 ATATTCCAGGCACTGTTCTAAGG - Intergenic
1178411899 21:32370909-32370931 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1178461587 21:32807217-32807239 ATGTGCCAGGCCCTGTGCTAAGG - Intronic
1178763247 21:35424392-35424414 ATATGCCAAGCAGTGTGTAATGG + Intronic
1178769123 21:35485905-35485927 AAGTGCAAGGTACTGTGCTAGGG - Intronic
1179315002 21:40236220-40236242 ATATGCCAAGCACTGAGCCCAGG + Intronic
1181743117 22:24937012-24937034 ATGTATGAAGCACTGTGCTAGGG + Intronic
1182323158 22:29491452-29491474 ATGTGCCAGGCAGTGTGCTAGGG + Intergenic
1182392529 22:30010927-30010949 GTATGCTAGGCACTGTGCTGGGG + Intronic
1182575274 22:31268740-31268762 ATATGCTAGGCACTGGGCTGAGG + Intronic
1183047313 22:35230463-35230485 AAAGGCAAAGCACAGTGCCAGGG + Intergenic
1183224222 22:36538290-36538312 TTATGCCAGGCACTGTGCTATGG + Intergenic
1184472580 22:44704131-44704153 ATGTGCTAAGCACTGTGTTGAGG - Intronic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
949239075 3:1848122-1848144 ATGTGCTATGCACTGTGATAGGG - Intergenic
950580892 3:13861402-13861424 ATGTGCCAGGCACTGTTCTAGGG + Intronic
950914884 3:16634295-16634317 GTGTGCCAGGCACTGTGCTAAGG - Intronic
950966934 3:17152967-17152989 ATGTGCCAAACACTGTGCTGGGG - Intergenic
951032713 3:17900503-17900525 ATATGCAAAGATCTGTCATATGG - Intronic
951126838 3:18994903-18994925 ATATGTAAAGCACCTAGCTAAGG - Intergenic
951883487 3:27501934-27501956 ATATGCCAAGCAGTACGCTAAGG + Intergenic
951898838 3:27636779-27636801 ATATGAGAAGCACTGGGCTAGGG + Intergenic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952304076 3:32130040-32130062 GTAGGAAAAGCACTGTGCTAGGG - Intronic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952624602 3:35389561-35389583 TTAGGCAAAGCACTGTGGGATGG - Intergenic
952820915 3:37484851-37484873 ATATGCCAGACACTGTTCTAAGG - Intronic
952925641 3:38317293-38317315 ACATGCTAGGCACTGTGCCAGGG + Intronic
953126884 3:40099341-40099363 ATATGCAAAGCATTGTAATTTGG + Intronic
953135248 3:40176394-40176416 ATTTGCACAGCACTGGTCTAGGG + Intronic
953266435 3:41393688-41393710 ATGTGCAAAGCACTGCACCAGGG - Intronic
954116675 3:48470455-48470477 GTATGCCAAGCACCGTGCCAGGG + Intronic
955134104 3:56199035-56199057 ATATGACAGGCACTGTGCTAAGG + Intronic
955142373 3:56282049-56282071 CTATGCAAAGCACTTTGCACAGG - Intronic
955145707 3:56316986-56317008 GTGTGCTAAGCACTATGCTAAGG + Intronic
955304420 3:57815352-57815374 AAATACAAAACACTGTGATATGG - Intronic
955949517 3:64228170-64228192 ATTTGCCAGTCACTGTGCTAGGG + Intronic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
956374851 3:68603426-68603448 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
956389065 3:68752337-68752359 ATTGGCACAGCACTCTGCTAGGG + Intronic
956737110 3:72246436-72246458 AGATCCCAGGCACTGTGCTAAGG - Intergenic
956747982 3:72324463-72324485 ATGTGCCAGGCACTATGCTAGGG + Intergenic
956914363 3:73855541-73855563 CTCTGCAGAGCACTTTGCTAAGG + Intergenic
957891318 3:86362905-86362927 ATATGCAAAGCACTGAGGTGAGG - Intergenic
957972356 3:87398907-87398929 ATATTTAAAACACTGTCCTATGG - Intergenic
958458240 3:94360298-94360320 ACATGCCAAGCAATGTGTTATGG + Intergenic
958798395 3:98730880-98730902 ATCTGCAAAGCAGTGTGCTAAGG - Intergenic
959160031 3:102712126-102712148 ATGTGCAAGGCACTATTCTAGGG - Intergenic
959299019 3:104575905-104575927 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
959397400 3:105857973-105857995 CTAGGCAAAGGAGTGTGCTAAGG + Intronic
959597918 3:108147851-108147873 ATATACAAAGGGCTGTGCCAGGG - Intergenic
959637659 3:108593212-108593234 ATGTGCCAAGCACTGTCCTAAGG + Intronic
959670871 3:108975711-108975733 ATATGCTAGGCACAGTCCTAAGG - Intronic
960116662 3:113901518-113901540 ACATGCTAAGCACTATGTTAGGG - Intronic
960277279 3:115742439-115742461 ATCTGCACAGCTCTGTGCTTAGG + Intergenic
960703465 3:120459630-120459652 ATATCCAATGCCCTGTGCTCAGG - Intergenic
961189319 3:124944479-124944501 GTTTGGAAAACACTGTGCTAGGG + Intronic
961620443 3:128219740-128219762 ACATGCCAAGCACTATGCTAAGG - Intronic
962036438 3:131656606-131656628 ATATGCCAAGCACTGTTTTAGGG + Intronic
962209911 3:133468930-133468952 AACTGCCAGGCACTGTGCTAAGG - Intronic
962417729 3:135198746-135198768 ATACACAAGGCACTGAGCTAGGG + Intronic
962848978 3:139293856-139293878 CTGTGCCAAGAACTGTGCTAGGG - Intronic
963227533 3:142877524-142877546 TTGTGCCAAGCACTGTGCTAAGG + Intronic
963486657 3:145942767-145942789 ATACGCCAACCACTATGCTAAGG + Intergenic
963882456 3:150544258-150544280 TTTTGCAAGGCACTGTGGTATGG + Exonic
964295216 3:155225686-155225708 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
964434039 3:156633746-156633768 ATATTCAATGCCTTGTGCTAAGG + Intergenic
964445657 3:156754620-156754642 AAATGCACAGAACTGTACTATGG + Intergenic
964569005 3:158092282-158092304 ATATGCAAGGCATTGTTCTAAGG + Intergenic
964687723 3:159415809-159415831 ATGTGCCAGGCACTGTACTAGGG - Intronic
965488207 3:169304905-169304927 ACGTGCAAGGCACTGTGCTAGGG + Intronic
965611905 3:170553210-170553232 ATATGCTAGGCACTGTGCTTGGG - Intronic
965932017 3:174056005-174056027 ATATGCTAAGTATTGTGCTCTGG + Intronic
966551600 3:181211089-181211111 ATATGCACAGCACAGAGATAGGG + Intergenic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
967275836 3:187773758-187773780 TAATGCAAGGCACAGTGCTAAGG - Intergenic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967789266 3:193529856-193529878 GATTTCAAAGCACTGTGCTAAGG - Intronic
969179420 4:5425507-5425529 ACATGCTAGGCACTGTTCTATGG + Intronic
969603659 4:8191146-8191168 AGATGAGGAGCACTGTGCTAAGG + Intronic
970936436 4:21576382-21576404 AAATGCAAAATACTGTGCTCTGG - Intronic
970936667 4:21579206-21579228 AAATGCAAAATACTGTGCTCTGG - Intronic
971135928 4:23868507-23868529 ATGTGCACAGCTTTGTGCTAGGG + Intronic
971286061 4:25291077-25291099 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
971406467 4:26325005-26325027 AAATGCAAAACACTTTTCTAAGG - Intronic
971982959 4:33778601-33778623 ATATGCTAAGCAATCTGCCAAGG + Intergenic
971993239 4:33929093-33929115 AAATGCCAGGCACTGTACTAGGG + Intergenic
972152858 4:36116641-36116663 ACATGCTGAGCAATGTGCTAAGG + Intronic
972275494 4:37553809-37553831 ATATGCAAGTCACTGTGCCAAGG + Intronic
973107430 4:46357570-46357592 ATGTGCCAGGCACTGTTCTAGGG + Intronic
973210125 4:47606084-47606106 CTATGCCAAGCATTGTGTTAGGG + Intronic
973647876 4:52968200-52968222 GTGTGCCAGGCACTGTGCTAGGG + Intronic
973705709 4:53577949-53577971 ATGCGCCAGGCACTGTGCTAGGG + Intronic
974426281 4:61746696-61746718 ATATTCAAAGCAGTGTGTAAAGG + Intronic
974724009 4:65776174-65776196 ATATGTCAGGCACTGTACTAAGG - Intergenic
974794130 4:66726950-66726972 CTGTGCCAAGCACTGTGCCAAGG + Intergenic
975359075 4:73445625-73445647 ATGTGCCAGGCATTGTGCTATGG - Intronic
975613375 4:76222743-76222765 ATATGCCAAGCTCTGTTCTAAGG + Intronic
975691915 4:76973819-76973841 ATATGCCAGGCACTGGTCTAAGG - Intronic
976396747 4:84564228-84564250 ATATGCAAAGCTCTGGGAAAAGG + Intergenic
976468813 4:85403101-85403123 TTATGCTAGACACTGTGCTAAGG + Intergenic
976836042 4:89375081-89375103 ATGTGCCAGGCACTGGGCTAAGG - Intergenic
977421733 4:96809266-96809288 TTATGCTAAGCACTGGGCTAAGG - Intergenic
977563301 4:98555593-98555615 GTATTCAAGGCACTGTGCTGGGG - Intronic
977606533 4:98990041-98990063 ATATATCAAGCATTGTGCTAGGG + Intergenic
977809227 4:101339720-101339742 ATAAGCAAGGCATTGAGCTAGGG + Intronic
977849367 4:101807131-101807153 ATTTGCAAAGCACTGTCCCAGGG - Intronic
978054003 4:104240209-104240231 ATATGCAAGGCACTGTGTTAAGG - Intergenic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
978495604 4:109356513-109356535 ACTTCCAAAGCACTCTGCTAGGG - Intergenic
978955061 4:114602566-114602588 GTGTGCCAAGCACTGTGCTCTGG + Intronic
978981028 4:114945463-114945485 ATGTACCAAGCACTCTGCTAAGG - Intronic
979732866 4:124045616-124045638 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
980008410 4:127567231-127567253 ATGTGCCAAGCAATGTGCCAAGG + Intergenic
980190468 4:129518816-129518838 ATATGCCAGGCACTGTTTTAGGG + Intergenic
980264902 4:130502721-130502743 CTATGCTAGGCACTGTGATAGGG + Intergenic
980509008 4:133760249-133760271 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
980949319 4:139357170-139357192 ATATGAAAGGGATTGTGCTAGGG + Intronic
981209804 4:142089834-142089856 ATTTGCAAAGCCCTGAGTTAGGG + Intronic
981273789 4:142874718-142874740 ATCTGCATAGCTCTGTGCTTGGG - Intergenic
981322811 4:143412475-143412497 ATGTACTAGGCACTGTGCTATGG + Intronic
981573822 4:146182518-146182540 TTATGCAAAGCATTCTGCTAAGG - Intronic
981972804 4:150685754-150685776 CTGTGCAAAACACTATGCTAGGG + Intronic
982256395 4:153455471-153455493 ATATGCAAAGCACTTAGGAAAGG + Intergenic
982372260 4:154647069-154647091 ATCTGCACAGCTCTGTGCTTGGG - Intronic
982610628 4:157569751-157569773 ATATGCTAGGCACTGTTCTAGGG + Intergenic
983212497 4:164973141-164973163 ATATGTCAGGCACTATGCTAAGG + Intronic
983330410 4:166320337-166320359 ACATACCAAGCCCTGTGCTAAGG - Intergenic
983435027 4:167702526-167702548 AAATCCATAGCACTGTGCCATGG + Intergenic
983566849 4:169162493-169162515 TTCTGGAAAGCACTGTGCTGGGG + Intronic
983720245 4:170842697-170842719 ATATTCAAAGAACTGTGATTAGG + Intergenic
984090821 4:175373199-175373221 GTATGCCAGGCACTGTGCTATGG - Intergenic
984286783 4:177740392-177740414 ATATTCCAAGCACTGTCCCATGG - Intronic
984541921 4:181049551-181049573 ATATGCAAAGCACTTGACTATGG + Intergenic
984853942 4:184177051-184177073 ATCTGCACAGCTCTGTGCTTGGG - Intronic
986596980 5:9432843-9432865 AGAAGCAAAGCACTGTGATCAGG + Intronic
987200889 5:15576936-15576958 ATATTCACACCACTGTGTTAGGG - Intronic
988206949 5:28150098-28150120 ATATGTACAGTACTGTACTATGG + Intergenic
988412047 5:30898975-30898997 ATGTGCCAGGCACTGTGGTAGGG + Intergenic
988514994 5:31896525-31896547 ATGTGCCAAGCCCTGTGCTAAGG + Intronic
989733910 5:44679658-44679680 ATTGGCAAAGCAGTGTGTTAGGG - Intergenic
990148743 5:52791628-52791650 ATGTGCAAGGCACTGTGCCAAGG + Intronic
990305663 5:54492258-54492280 ATATGGACAGCACGGTGCTGTGG + Intergenic
990595832 5:57311466-57311488 AGATGCAAAGCACTATGGCAGGG + Intergenic
990915682 5:60902031-60902053 ACGTGCCAAGCATTGTGCTAGGG - Intronic
990943587 5:61228289-61228311 ATGTGCCAGGCACTGTGGTAGGG - Intergenic
991284882 5:64961849-64961871 ATATGTCAAGCACTATGCTAGGG - Intronic
991423142 5:66462162-66462184 CAATGCCAGGCACTGTGCTAGGG + Intergenic
992035443 5:72770089-72770111 ATATGCCATGCACTGTGCCAAGG - Intergenic
992062854 5:73073500-73073522 ATGTGCCAGGCACTTTGCTAGGG - Intronic
992706363 5:79398344-79398366 ATATGTAAAGAACTGTGATAGGG - Intronic
992762827 5:79966385-79966407 ATGTGCGAAGCTCTGTGCTAGGG + Intergenic
993038623 5:82786484-82786506 ATGTGCCAAGCACTGTTTTAAGG + Intergenic
993421060 5:87701200-87701222 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
993767104 5:91873874-91873896 ATGTGCTAGCCACTGTGCTAAGG + Intergenic
994045268 5:95302177-95302199 AAATGCAGAGAACTGTCCTAGGG + Intergenic
994244075 5:97458868-97458890 ACATGCCAAGCACTGTTTTAAGG - Intergenic
994337480 5:98585075-98585097 ATATGTTAGGCACTTTGCTAAGG + Intergenic
994466749 5:100144284-100144306 ATATGCAAAGCAGTGTGTGAAGG - Intergenic
994683776 5:102923721-102923743 ATATGGAAACCTCTGTGATAGGG - Intronic
995052164 5:107719299-107719321 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
995074993 5:107972131-107972153 CTGTGCAAAGCACTGTGCACAGG - Intronic
995500692 5:112803582-112803604 ATATGCCAGGGACTGTGTTAAGG - Intronic
995807495 5:116069848-116069870 TTGTGCCAAGCTCTGTGCTAGGG - Intergenic
995921209 5:117315463-117315485 ATACTCAAAGCATTGTGCTTAGG + Intergenic
996879871 5:128284172-128284194 CTATGCCAAGCATTGTACTAAGG + Intronic
997258750 5:132449270-132449292 ATATGCCAGGCACTGTCCTAGGG - Intronic
997276342 5:132595301-132595323 ATGTGCCAGGCACTGTTCTAAGG - Intronic
997401295 5:133605033-133605055 ATGTGCTAAGCATTGTGCTGAGG + Intronic
997662080 5:135597041-135597063 ATATGCTAGGCACTATGCTGGGG - Intergenic
997720643 5:136076040-136076062 GTATGCCAAGCACTATGCTAGGG + Intergenic
998045368 5:138982736-138982758 ATCTGAAAAGAACTATGCTAGGG - Intronic
998344042 5:141445417-141445439 ATATGCAAGGCACTGACCTATGG + Intronic
998535270 5:142924531-142924553 ATGTGCTAACCACTGTGCTAAGG - Intronic
999120311 5:149204663-149204685 ATGGGCCAAGCATTGTGCTAAGG + Intronic
999416021 5:151396735-151396757 ATGTGACAAGCACTGTGCTAAGG + Intergenic
999679987 5:154047991-154048013 ATCAGCCAAGCACTGTGCTAGGG - Intronic
1000365445 5:160486491-160486513 ATGTGCCAAGCACTGTGCTCAGG + Intergenic
1000602783 5:163295476-163295498 AAATGCAAGGAACTGTACTACGG + Intergenic
1001003159 5:168026767-168026789 TTTGGCCAAGCACTGTGCTAAGG - Intronic
1001133074 5:169080344-169080366 ATGTGCCAAGCACTGTGCTAGGG + Intronic
1001770389 5:174291756-174291778 ATATGCCATGCATTGTGCTAAGG + Intergenic
1001887407 5:175306597-175306619 ATGAGTAATGCACTGTGCTATGG + Intergenic
1001962539 5:175888423-175888445 ATGTGCCTGGCACTGTGCTAGGG - Intergenic
1003507548 6:6752119-6752141 CTGTGCAAAGCACTGAGCCATGG + Intergenic
1003638455 6:7856482-7856504 AAATGCAAAGGAATGTGTTATGG + Intronic
1004143163 6:13040046-13040068 AGATGCAAAGTACTGTGCAAAGG - Intronic
1004323364 6:14650972-14650994 ATGTGCCAGGCATTGTGCTAAGG + Intergenic
1004360714 6:14968288-14968310 GTGTGCCAAGCACTGGGCTAGGG + Intergenic
1005029582 6:21496158-21496180 GTGTGCAAAGCAATGTGCAAAGG - Intergenic
1005034402 6:21542506-21542528 ATATCCCAAGCACTGTTCTTAGG + Intergenic
1006567419 6:34972243-34972265 ATACTCAAAGCACTGGGCTGGGG - Intronic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007159580 6:39778203-39778225 GTGTGCCAAGCGCTGTGCTAGGG - Intergenic
1007462414 6:42028115-42028137 ACATGCTAGGCACAGTGCTAGGG - Intronic
1007698982 6:43754587-43754609 ATATACCAGGCCCTGTGCTAGGG - Intergenic
1007725870 6:43915252-43915274 ACATGCCAGGCACTGGGCTAGGG + Intergenic
1007845078 6:44747736-44747758 ATTGGAAAAGCACAGTGCTAGGG - Intergenic
1007861035 6:44908708-44908730 CTATGCAAAGAACTGTGGAAAGG + Intronic
1008055847 6:46945461-46945483 ATGTGCCAGGTACTGTGCTAGGG + Intronic
1008075879 6:47145970-47145992 ATTTGCCAAGCACTGTGTTTAGG + Intergenic
1008880422 6:56375635-56375657 ATATGAAAACCACTGTGTAAAGG - Intronic
1009353696 6:62712927-62712949 ATTTGCAAAGCACGATGCTGAGG + Intergenic
1010472708 6:76248667-76248689 AAATGCAAAGCCATGTGCTCTGG - Intergenic
1011126742 6:84015632-84015654 ATGTGCCAACCAGTGTGCTAGGG - Intergenic
1011515689 6:88150019-88150041 AAATGCAAATCACTGTTTTAAGG - Intronic
1011809264 6:91111629-91111651 ATTTGCAAAGTACAGTGCTCTGG - Intergenic
1011850415 6:91620719-91620741 ATATGCCAGACACTGTACTATGG + Intergenic
1012200576 6:96401430-96401452 ATGTGCCAGACACTGTGCTAAGG - Intergenic
1012315018 6:97774940-97774962 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1012739336 6:102994622-102994644 ATATGCCAAACTCTGTGCTAAGG - Intergenic
1012850558 6:104441872-104441894 CTACGCCAGGCACTGTGCTAAGG - Intergenic
1012864874 6:104606845-104606867 ATGTGCAAGGCACTGTCCTGTGG - Intergenic
1012987732 6:105892930-105892952 ATGTCCCAAGCACTGTGCTGGGG - Intergenic
1013604457 6:111734862-111734884 ATGTGACAGGCACTGTGCTAAGG + Intronic
1013615429 6:111838546-111838568 ATGTGCAAAGCCCTGTTCCAAGG - Intronic
1014457891 6:121657969-121657991 ATATACCAGGCACTATGCTAGGG - Intergenic
1014997072 6:128160707-128160729 ATTTGCAGTGCACTGTGCTAAGG - Intronic
1014997201 6:128163270-128163292 ATTTTCAGTGCACTGTGCTAAGG - Intronic
1015180971 6:130362178-130362200 ATTTGAAAAGCACTGCACTAGGG - Intronic
1015187442 6:130434199-130434221 ATATGCCAGGCACTCTGCCAAGG + Intronic
1015608266 6:134984323-134984345 ATGTGCCAGGCACTGGGCTAGGG + Intronic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1015936912 6:138413758-138413780 ATGTTCCAAGCACTCTGCTAAGG + Exonic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016454061 6:144213475-144213497 ATGTGAAAAGCACTGTGCCATGG - Intergenic
1016731265 6:147430890-147430912 GCATGCCAAGCGCTGTGCTAAGG + Intergenic
1017229282 6:152054899-152054921 ATCTGTAAAGCAGGGTGCTATGG + Intronic
1017329117 6:153174836-153174858 GGATGGGAAGCACTGTGCTAAGG + Intergenic
1017533135 6:155316995-155317017 ACTAGCAAAGCACTGTGCTATGG - Intergenic
1017751127 6:157491394-157491416 ATACGCAAAGCAGTGTGCTCTGG - Intronic
1020333125 7:7040424-7040446 ATATCCAATGGACAGTGCTATGG - Intergenic
1021312329 7:19110065-19110087 ATATTCAATGAACTGTGCTGTGG - Intronic
1021776470 7:24059617-24059639 ATCTGCACAGCTCTGTGCTCAGG - Intergenic
1021848225 7:24783358-24783380 ATGTGCAAGACACTGTTCTAAGG - Intergenic
1021906290 7:25337243-25337265 ATATACCAAGCATTGTACTATGG + Intergenic
1021941251 7:25680846-25680868 ATGTGCAAATCACTGTGGTGTGG - Intergenic
1022032607 7:26506049-26506071 ATATGTCAAGCACTGGGCTAAGG - Intergenic
1022582446 7:31569366-31569388 AAGTGCAAAGCAGAGTGCTAGGG - Intronic
1023109250 7:36793447-36793469 CTGTGCAAAGCACTGTGCCAAGG - Intergenic
1023117232 7:36874454-36874476 ATATGCTAGGCCCTGTGCTAAGG - Intronic
1023628053 7:42136454-42136476 ATGTGCCAAGCACTGGGCTGAGG - Intronic
1023656835 7:42431803-42431825 ATATGTTAGGAACTGTGCTAGGG + Intergenic
1024083073 7:45872332-45872354 GTATGCAACGCAGGGTGCTAAGG + Intergenic
1024589940 7:50872537-50872559 ATTTGCACAGCTCTGTGCTTGGG - Intergenic
1025871597 7:65439355-65439377 ATGTACCAAGCACTGTGCTAGGG - Intergenic
1026333970 7:69378069-69378091 ATGTGCCAAGCATTATGCTAGGG + Intergenic
1026375130 7:69742422-69742444 ACATGCCAAGCATAGTGCTAAGG - Intronic
1026377193 7:69763742-69763764 ACATGCCAAGCACTGTTCTAAGG - Intronic
1027423319 7:78038193-78038215 ATGTGCCCAGCACTGTGTTAGGG - Intronic
1027429574 7:78096404-78096426 ATGTGTCAGGCACTGTGCTAAGG - Intronic
1027579408 7:79975589-79975611 ATATGCCAGGCACTGTTGTAGGG + Intergenic
1027659283 7:80969823-80969845 ATATGCAAAGCACCCTGTGAAGG - Intergenic
1027667742 7:81059779-81059801 ATGTGCAATGCAATATGCTAGGG + Intergenic
1027916093 7:84323298-84323320 AGATGCAATTCACTGTGGTAGGG + Intronic
1029897957 7:104006289-104006311 ATATGCCAAGCATCGTGCTAGGG + Intergenic
1030143439 7:106328810-106328832 TCATGCCAAGCATTGTGCTAAGG + Intergenic
1030826135 7:114160515-114160537 ATATACCAAGCTCTGTCCTAAGG + Intronic
1032534453 7:132650323-132650345 ATGTGCCAAGCACTATTCTATGG - Intronic
1032875237 7:136031651-136031673 ATATGCCAGGCACTGAGTTAGGG + Intergenic
1032889343 7:136177761-136177783 TTAAGCCAAGCACTGTGCTAGGG - Intergenic
1032993003 7:137414407-137414429 ATGTGCAAAGCATTATGCTAGGG - Intronic
1033433210 7:141307792-141307814 ATATTCCAGGCACTGGGCTAAGG + Intronic
1033915213 7:146315415-146315437 AAATGTAAGGCACTGTGCTCAGG + Intronic
1034747802 7:153538604-153538626 CTATGCAAAGCACTATTCTGGGG + Intergenic
1034883126 7:154777499-154777521 AAATGCAAATCGCTGTGCTGTGG + Intronic
1035954662 8:4063442-4063464 ATATGCCAGGCATTGTTCTAAGG - Intronic
1036486032 8:9179461-9179483 ATGTGCAAGGCAGTGGGCTAGGG + Intergenic
1037407633 8:18560778-18560800 ATGGGCAAAGGACTTTGCTATGG + Intronic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1037630182 8:20648874-20648896 ATGTGCCAGGCATTGTGCTATGG - Intergenic
1037924127 8:22831516-22831538 ATATACTAAGCACCATGCTAAGG + Intronic
1038246788 8:25865563-25865585 ATATGCCAAGCACCGTGCTGAGG - Intronic
1038797200 8:30720432-30720454 ATGTGCAAAACACTGTTCTAGGG + Intronic
1038833904 8:31097146-31097168 ATATGCCAAGCACTGCACTGGGG - Intronic
1039058254 8:33553754-33553776 ATCTGCCCTGCACTGTGCTACGG - Intronic
1039076501 8:33694675-33694697 CTCTGCAAAGCACTGTACCAGGG - Intergenic
1039326833 8:36494828-36494850 CTGAGCAAAGAACTGTGCTAAGG + Intergenic
1039835562 8:41253722-41253744 ATGTGCAAGGCACTGTACTGAGG + Intergenic
1039876470 8:41590616-41590638 ACATGCCCAGCACTGCGCTAAGG - Intronic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1040539205 8:48337097-48337119 ATATTCAAAGCAGTGTGCAGAGG - Intergenic
1041412942 8:57576645-57576667 AAGTGCAAAGCTCTGTGCTGGGG + Intergenic
1041694432 8:60720822-60720844 ACATGCCAGGCCCTGTGCTAAGG - Intronic
1041697387 8:60750326-60750348 ATGTGCCAAGGACTGTGTTAAGG + Intronic
1042116687 8:65439536-65439558 ATATGCCAGGCATTATGCTAAGG - Intergenic
1042183664 8:66115855-66115877 ATGTGCCAGGCACTGTACTAAGG - Intergenic
1042262939 8:66878324-66878346 TTTTGCAAGGCACTGTGCTAAGG - Intronic
1042271382 8:66959656-66959678 ATGTGCAAAGCACTATTTTAGGG - Intronic
1042769985 8:72369020-72369042 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
1042977578 8:74487104-74487126 ATGTGCCAGGCACTGTGCCATGG - Intronic
1043028161 8:75097707-75097729 ATATGCAAATCATTGTAGTAAGG - Intergenic
1043873130 8:85457335-85457357 ATGGGCAAAGCCCTGTCCTAGGG + Intergenic
1044349875 8:91151238-91151260 ACATGCAAAGCACTGTGTAGAGG - Intronic
1044353592 8:91194996-91195018 ACATGCAAAGCACTGTGTAGAGG - Intronic
1044508646 8:93049611-93049633 ATCTGCACAGCTCTGTGCTTAGG + Intergenic
1044545103 8:93450518-93450540 ATGTGGCAAACACTGTGCTAGGG + Intergenic
1044613144 8:94114132-94114154 ACATGCTGAGCACTGTGTTAAGG - Intergenic
1045426491 8:102071414-102071436 ATGTTTAAAGCACTATGCTAGGG + Intronic
1045471684 8:102518319-102518341 GTGTGCCAAGCACTGTGCTAAGG + Intergenic
1045664933 8:104474113-104474135 ATATAGCAAGCACTGTGCTGTGG - Intergenic
1046702664 8:117418700-117418722 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1046779056 8:118195761-118195783 ATGTGCCAAGCATTGTGCTTGGG - Intronic
1046961118 8:120113996-120114018 ATATGCTAAGCCAGGTGCTAGGG + Intronic
1047416148 8:124666284-124666306 ACATGCAAGGCACTGTGCTCAGG + Intronic
1047708287 8:127524409-127524431 ATTTCCCATGCACTGTGCTATGG - Intergenic
1047775031 8:128063061-128063083 AAAGGCCAAGTACTGTGCTAGGG - Intergenic
1047842841 8:128772742-128772764 ATATACCATGCACTGTGCTAAGG - Intergenic
1047870906 8:129081033-129081055 GTATGAAAAGCACTGTGCACTGG + Intergenic
1048069270 8:131004667-131004689 ATAGGTCAAGCAGTGTGCTAGGG + Intronic
1048233509 8:132667351-132667373 GTATACCAGGCACTGTGCTAAGG - Intronic
1048557804 8:135497690-135497712 ATATATCAAGCACTGTGCTTAGG + Intronic
1049022216 8:139965194-139965216 ACGTGCAAAGCACTGTGCTAGGG - Intronic
1049078565 8:140421638-140421660 CTATGCCAGGCACTGTGCGAGGG + Intronic
1049215084 8:141404098-141404120 ATGTGCACAGCACTGGGGTATGG + Intronic
1050267190 9:3903616-3903638 ATATGCCAGGCACTGTTCTAGGG + Intronic
1050810863 9:9745796-9745818 ATATGAAAAGCACTGTGATGGGG - Intronic
1050843516 9:10184527-10184549 ATATTCTATGCATTGTGCTAGGG - Intronic
1051070139 9:13156122-13156144 ATGTGCCAGGCACTCTGCTAAGG + Intronic
1051291337 9:15548741-15548763 ATGTGCCAAGCACTATACTAAGG - Intergenic
1051512187 9:17890266-17890288 ATATGCCAGACACTGTTCTAAGG - Intergenic
1051544915 9:18263118-18263140 ATGTGCCAACCATTGTGCTAGGG - Intergenic
1051685439 9:19653714-19653736 ATATGCCAGGCATTGTGCCAGGG - Intronic
1051809744 9:21034972-21034994 CTATGCCAAGCACTGTACTAGGG - Intergenic
1052312536 9:27083396-27083418 ACATGCAAAGCATTATTCTAGGG - Intergenic
1052787259 9:32840469-32840491 ATATGTCAGGCATTGTGCTAAGG - Intergenic
1055507636 9:76964474-76964496 AAATGCTAGGCACTGTCCTAAGG + Intergenic
1056553554 9:87671156-87671178 AGATGCAAAGCACCTTGCTGCGG + Intronic
1057470365 9:95351063-95351085 ATGTGCAAAGCCCGGTGCTGGGG + Intergenic
1057555010 9:96081086-96081108 ATGTGCCCAGCACTGTGATAAGG + Intergenic
1057695165 9:97317997-97318019 ATGAGCCAAGCACAGTGCTAGGG + Intronic
1057766046 9:97920151-97920173 TTTTGGTAAGCACTGTGCTAAGG + Intronic
1058278489 9:103079154-103079176 ATATGCCAAAAACTGTGTTAAGG + Intergenic
1058422659 9:104847415-104847437 ATGTGCCAGGCACTGTGCGAGGG - Intronic
1058626071 9:106934084-106934106 ATATACCAGGCACTGTACTAAGG + Intronic
1058652796 9:107192538-107192560 ATGTGCTAGGCACTGTTCTAAGG + Intergenic
1058708188 9:107654947-107654969 GTATGCAAAGCACTGTAGAAGGG - Intergenic
1058793502 9:108474104-108474126 ATCTGCTAGGCACTGAGCTAGGG + Intergenic
1058923366 9:109639446-109639468 ATATGCAAGCCACAGGGCTAGGG - Intergenic
1059019676 9:110561644-110561666 ATATACCAGGCACTGTACTAGGG + Intronic
1059072831 9:111157175-111157197 ATATACAAAGCACAGTTATATGG + Intergenic
1059170224 9:112117733-112117755 ATATTTAAGGCACTGTGCTAGGG - Intronic
1059306976 9:113361407-113361429 ATATGTGAAGCACTGTGCTATGG + Intronic
1059463407 9:114449854-114449876 ATGTGCCAGGCACTGGGCTAGGG + Intronic
1059686619 9:116643669-116643691 ATGTGCCAAAAACTGTGCTAAGG - Intronic
1059704036 9:116803035-116803057 ATTTGCAAAGCAGTGTTCCAAGG - Intronic
1059771652 9:117432181-117432203 AAGTGCAGAGCACTGTTCTAGGG - Intergenic
1059854102 9:118376292-118376314 ATTTGCCAGGCACTGTGCCAAGG - Intergenic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1060139711 9:121199982-121200004 ATATGCCAAGCAATGTGCTAAGG + Intronic
1060144982 9:121244126-121244148 ATTTCAAATGCACTGTGCTAAGG - Intronic
1060239909 9:121894113-121894135 ATATGCCAAGCACTGGGCACGGG + Intronic
1060433157 9:123568384-123568406 GTGTGCCAGGCACTGTGCTAGGG - Intronic
1060521625 9:124297322-124297344 ATGTGCCAGGCTCTGTGCTAAGG + Intronic
1060716929 9:125940433-125940455 ATGTGCCAAATACTGTGCTAGGG + Intronic
1060730844 9:126036059-126036081 ATGTGCCAAGCACTGTGCTAAGG + Intergenic
1060824611 9:126680817-126680839 ATGTGCCAGGCACTGTGCGAAGG - Intronic
1060887753 9:127167541-127167563 AAATGCCAGGGACTGTGCTAAGG - Intronic
1062737007 9:138142842-138142864 ACTTTCAAAGCACTGGGCTAAGG - Intergenic
1186829008 X:13371723-13371745 ATATGGAAACCACTGTTATATGG - Intergenic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1187376636 X:18761263-18761285 CTGGGCCAAGCACTGTGCTAAGG - Intronic
1187584226 X:20642007-20642029 ATATGCCAAGCACTGGACCATGG - Intergenic
1187963601 X:24589023-24589045 ATGTGCCCGGCACTGTGCTAAGG - Intronic
1188512785 X:30954640-30954662 ATTTGCCAGACACTGTGCTAAGG - Intronic
1188741102 X:33783132-33783154 ATATGCAGAGTACCATGCTAGGG - Intergenic
1188932207 X:36125243-36125265 ATATGTTTAGCACTGTTCTAGGG + Intronic
1188963356 X:36520505-36520527 ATGTGCAAAACACTGAGCTGTGG - Intergenic
1189940192 X:46113115-46113137 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
1190225889 X:48544734-48544756 ATGTGCAAGGTACTGTGCCAAGG - Intronic
1190279617 X:48921043-48921065 ATGTGCCAAGCACTGTGCCCAGG + Intergenic
1191817354 X:65260962-65260984 ATATAACAGGCACTGTGCTATGG - Intergenic
1191911961 X:66160894-66160916 ACATGCTGAGCACTGTGCTAAGG + Intergenic
1192260341 X:69502653-69502675 ATGTTACAAGCACTGTGCTAGGG - Intergenic
1192344647 X:70290859-70290881 ATGTGCCAAGCACTGTGCTTGGG + Intronic
1193095688 X:77546281-77546303 TTATGCCAGGAACTGTGCTAAGG - Intronic
1193725140 X:85029397-85029419 ATGTGCACAACACTATGCTAGGG + Intronic
1193847151 X:86486848-86486870 ATATGTCTAGCACTATGCTAAGG - Intronic
1194622667 X:96192326-96192348 ATATGCAAAACATTGTACTAGGG - Intergenic
1194745849 X:97627605-97627627 ATTTGCTAGGCACTGTGCTAGGG + Intergenic
1194930363 X:99880631-99880653 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1195068355 X:101257177-101257199 GTTTGCAAAGCACTGCTCTAAGG - Intronic
1195238653 X:102928314-102928336 ATGTGCCAACCACTGTTCTAAGG + Intergenic
1195336002 X:103854952-103854974 ATATGCCAGGCACTCTGTTAGGG - Intergenic
1195658723 X:107357839-107357861 ATGTGCCAAGTACTGTGATAGGG - Intergenic
1195724559 X:107900912-107900934 CTGTGCAAAGCATTATGCTAAGG - Intronic
1195812617 X:108851259-108851281 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1195933760 X:110106026-110106048 ATGTGCAAATCACTGGGCTAAGG - Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1196038843 X:111178545-111178567 ATGTGCCATGTACTGTGCTAAGG - Intronic
1196284559 X:113864090-113864112 ATCTGCACAGCTCTGTGCTTGGG + Intergenic
1196522425 X:116689277-116689299 ATATGCTAAGCACTGTAGCAAGG - Intergenic
1196650624 X:118164995-118165017 ATTTGCCAGGCACTCTGCTAAGG - Intergenic
1197334164 X:125191627-125191649 CTAGGCAAAGCACTGTCCTAAGG - Intergenic
1197356691 X:125444614-125444636 ATATGCACATCTCTGTGCTTGGG - Intergenic
1197750731 X:129961872-129961894 ATATAGAAACCACTGTGCTGTGG - Intergenic
1198161448 X:134012610-134012632 ATGTTCCAAGCACTGTGCTAGGG + Intergenic
1198196796 X:134371550-134371572 ATGTACAAAGCACTATGCTGAGG - Intergenic
1198254127 X:134910457-134910479 ATATACAAGGCACTGTGCTAGGG + Intronic
1198282053 X:135151976-135151998 ATATGCCAAGCACTGGGCTAAGG - Intergenic
1198284354 X:135174963-135174985 ATATGCCAAGCACTGGGCTAAGG - Intergenic
1198286743 X:135198439-135198461 ATATGCCAAGCACTGGGCAAAGG - Intergenic
1198288906 X:135220546-135220568 ATATGCCAAGCACTGGGCTAAGG + Intergenic
1198398670 X:136249488-136249510 CTGTGCATAGCACTGTGCTGAGG - Intronic
1198639844 X:138744483-138744505 AAATGCCACGCACTGTGCTGAGG - Intronic
1198691885 X:139293446-139293468 AGACGCCAAGCACTGTGCTAAGG - Intergenic
1198720349 X:139611631-139611653 ATATGCTAAGCTCTGTGTTTAGG + Intronic
1198841291 X:140860781-140860803 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1199310789 X:146317654-146317676 ATCTGCACAGCTCTGTGCTTGGG - Intergenic
1199516337 X:148680584-148680606 ATATGCAGAGTATGGTGCTAGGG + Intronic
1199822300 X:151461487-151461509 ACATGCTAGGCACTGTGCTGAGG - Intergenic
1200081291 X:153577975-153577997 CTAGGCAAAGCACAGTGCTTCGG - Intronic
1200868562 Y:8073006-8073028 ATAACCAAAGCACTTTGGTAGGG + Intergenic
1201625472 Y:16010292-16010314 AAATGCAAAGCACTTAGCAACGG - Intergenic