ID: 917071155

View in Genome Browser
Species Human (GRCh38)
Location 1:171152326-171152348
Sequence ATATGCAAAGCACTGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 0, 2: 28, 3: 154, 4: 713}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917071152_917071155 28 Left 917071152 1:171152275-171152297 CCATTCTGTCTTTCATTCATTTT 0: 1
1: 1
2: 21
3: 560
4: 5061
Right 917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG 0: 1
1: 0
2: 28
3: 154
4: 713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917071155 Original CRISPR ATATGCAAAGCACTGTGCTA GGG Intronic