ID: 917074328

View in Genome Browser
Species Human (GRCh38)
Location 1:171188156-171188178
Sequence ATGTGAGTATGCAAGGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 3, 2: 14, 3: 71, 4: 419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917074328 Original CRISPR ATGTGAGTATGCAAGGATTT TGG (reversed) Intronic
900016927 1:158160-158182 ACTTGAGTATGCGTGGATTTTGG - Intergenic
900044818 1:497088-497110 ACGTGAGTAAGCATGGATTTTGG - Intergenic
900047188 1:516752-516774 ACTTGAGTATGCGTGGATTTTGG - Intergenic
900066221 1:731996-732018 ACGTGAGTAAGCATGGATTTTGG - Intergenic
900066617 1:735402-735424 ACGTGAGTAAGCATGGATTTTGG - Intergenic
900067013 1:738813-738835 ACGTGAGTAAGCATGGATTTTGG - Intergenic
900069402 1:758609-758631 ACTTGAGTATGCGTGGATTTTGG - Intergenic
903132278 1:21288130-21288152 AAGAGGTTATGCAAGGATTTGGG - Intronic
903967033 1:27097300-27097322 ACTTGAGCATGAAAGGATTTTGG + Intergenic
904419825 1:30384418-30384440 CTGTGAGTCAGCAAGGATTGTGG - Intergenic
905077461 1:35285722-35285744 ACTTGAGCATTCAAGGATTTTGG + Intronic
906235584 1:44206401-44206423 ACTTGAGTATGCATGGATTTGGG + Intergenic
906338915 1:44960785-44960807 ACATGAGCATCCAAGGATTTTGG + Intronic
906870013 1:49468166-49468188 ACTTGAGTATGTAAGGATTTTGG + Intronic
907452477 1:54554919-54554941 ATATGTGTTGGCAAGGATTTGGG - Intronic
907607529 1:55833075-55833097 ACTTGAGTATGCATGGGTTTTGG - Intergenic
907643409 1:56215759-56215781 ACTTGAGTATGCACGGATTTGGG - Intergenic
908410040 1:63854816-63854838 ACTTGAGCATCCAAGGATTTTGG - Intronic
908812155 1:67993007-67993029 ACTTGAGTATCCATGGATTTTGG - Intergenic
908863638 1:68520425-68520447 ACTTGAGTATGCACAGATTTTGG - Intergenic
909003155 1:70243220-70243242 ACTTGAGTATGCATGGATTCTGG - Intronic
909027148 1:70495107-70495129 GCTTGAGTATGCAAGGATTTTGG - Intergenic
909182879 1:72448074-72448096 TTGTGACTATGCAAGCACTTTGG - Intergenic
909355129 1:74699586-74699608 ACTTGAGTATGTGAGGATTTTGG + Intergenic
909823842 1:80100123-80100145 TGTGGAGTATGCAAGGATTTCGG + Intergenic
910050792 1:82972058-82972080 ATTTGAGCATCCACGGATTTTGG + Intergenic
910389293 1:86721823-86721845 ACCTGAGTATCCATGGATTTTGG - Intronic
911153240 1:94615409-94615431 ATGTGACTTTGCAAATATTTAGG - Intergenic
911315227 1:96348606-96348628 ACTTGATTATGCAAAGATTTTGG + Intergenic
911827301 1:102503916-102503938 ATGTGATTACTTAAGGATTTTGG - Intergenic
912265587 1:108153853-108153875 ATTTCAGTATGCAAGAAGTTTGG - Intronic
912914360 1:113797756-113797778 ATTTGGGTATGCAAGAATATCGG - Exonic
913033884 1:114941077-114941099 ATATGAGTATGCGCAGATTTTGG - Intronic
913193858 1:116436751-116436773 ACTTGAGCATCCAAGGATTTTGG + Intergenic
915119610 1:153620925-153620947 AATTGAGCATCCAAGGATTTTGG + Intronic
915187540 1:154119660-154119682 ACTTGAGTATGCGTGGATTTTGG + Intronic
916635444 1:166663022-166663044 ATTTGAGCATCCCAGGATTTTGG - Intergenic
916926767 1:169529641-169529663 ATGTGAGTCTCCAAGAACTTCGG + Exonic
917016295 1:170534430-170534452 ACTTGAGTATGCACAGATTTTGG + Intronic
917074328 1:171188156-171188178 ATGTGAGTATGCAAGGATTTTGG - Intronic
917783862 1:178430778-178430800 ATGTGAATATGTAGGGCTTTTGG + Intronic
917870446 1:179237301-179237323 ACTTGAGTATGCACGAATTTTGG - Intergenic
918260776 1:182793941-182793963 ACTTGAGTAGGCATGGATTTTGG + Intronic
918490340 1:185074883-185074905 ACTTGAGTATCCATGGATTTTGG + Intronic
919086067 1:192921603-192921625 ATTTGAGCATCTAAGGATTTTGG + Intergenic
919350318 1:196443779-196443801 ATGTTAATTTGAAAGGATTTGGG + Intronic
919660621 1:200241332-200241354 ATGTGATTATGCAAGGAAGGAGG + Intergenic
920543995 1:206800590-206800612 ATGTGAGTGTGCATGTGTTTAGG + Intronic
920935656 1:210432078-210432100 AAGTGAGCATCCATGGATTTTGG + Intronic
921293373 1:213679274-213679296 CTGTGAGTATGGAAGGACATAGG - Intergenic
921582694 1:216913354-216913376 ACTTGAGTATTCATGGATTTCGG + Intronic
922101337 1:222479347-222479369 ACGTGAGTAAGCATGGATTTTGG - Intergenic
922104766 1:222504008-222504030 ACTTGAGTATGCGTGGATTTTGG - Intergenic
922262420 1:223954456-223954478 ATGTGAGTAAGCATGGATTTTGG - Intergenic
922265077 1:223976522-223976544 ACTTGAGTATGCGTGGATTTTGG - Intergenic
922773574 1:228204085-228204107 ACTTGAGTATGCACAGATTTTGG + Exonic
923093518 1:230757156-230757178 ACTTGAGTATGCACAGATTTTGG + Intronic
924346940 1:243081532-243081554 ACTTGAGTATGCGTGGATTTTGG - Intergenic
924750615 1:246885236-246885258 ATTTGAGTATGTGTGGATTTTGG - Intronic
1062999634 10:1903714-1903736 ACCTGAGGAAGCAAGGATTTTGG - Intergenic
1063211461 10:3884829-3884851 ATGATAGTATTAAAGGATTTTGG - Intergenic
1063622574 10:7662592-7662614 ATGTGAGCATCCAAGGACTTGGG + Intronic
1065654130 10:27929152-27929174 ATTTCAGTATGGTAGGATTTTGG - Intronic
1065672545 10:28136064-28136086 AACTGAGTATGCGAGGATCTAGG + Intronic
1066025273 10:31351078-31351100 GTGTGAATATGCAGGGACTTGGG + Intronic
1066514532 10:36142488-36142510 ATGTGTGTATGCTCAGATTTAGG - Intergenic
1066729408 10:38423330-38423352 ACTTGAGTATGCGTGGATTTTGG + Intergenic
1066732076 10:38445606-38445628 ACGTGAGTAAGCATGGATTTTGG + Intergenic
1070046507 10:72843079-72843101 GGGAGACTATGCAAGGATTTGGG - Intronic
1070061437 10:72987179-72987201 ACTTGAGGATGCATGGATTTTGG - Intergenic
1070095987 10:73338847-73338869 ACTTGAGTATGCACGAATTTTGG + Intronic
1071086484 10:81873864-81873886 AGGTAAATATGAAAGGATTTGGG - Intergenic
1072673514 10:97448891-97448913 ATTTGAGCATCCATGGATTTTGG + Intronic
1073953536 10:108839720-108839742 ATGTAAGTATGTTAGGGTTTAGG + Intergenic
1074450177 10:113553026-113553048 ATGTCAGTCTCCAAGGATTCAGG - Exonic
1074464574 10:113669857-113669879 ACTTGAGCATGCATGGATTTTGG - Intergenic
1075076538 10:119354898-119354920 AGTTGAGAATGCATGGATTTTGG + Intronic
1075133531 10:119761983-119762005 ACTTGAGCATGCATGGATTTTGG - Intronic
1075289917 10:121220197-121220219 ACTTGAGTATGCAGGGATGTTGG - Intergenic
1075927527 10:126265023-126265045 ATGTGAAAATACAAGGCTTTTGG + Intronic
1076971143 11:133567-133589 ACGTGAGTAAGCATGGATTTTGG - Intergenic
1076973530 11:153375-153397 ACTTGAGTATGCGTGGATTTTGG - Intergenic
1078445328 11:11400428-11400450 ATGTGAGTAATCAAGGACTGCGG + Intronic
1078539968 11:12205463-12205485 ACTTAAGTATGCATGGATTTTGG + Intronic
1078961452 11:16277323-16277345 ATGTGAGGATGCCAGGATGCAGG + Intronic
1079863503 11:25704922-25704944 ATGAGAGTAAGGTAGGATTTTGG + Intergenic
1079976204 11:27094532-27094554 TTGTTGGCATGCAAGGATTTAGG - Intronic
1080067621 11:28037522-28037544 ACTTGAGTATCCATGGATTTTGG + Intronic
1081944402 11:46976774-46976796 ACTTGAGTATGCACAGATTTTGG - Intronic
1082261696 11:50080781-50080803 ATGTGAGTATGCATGGATTTTGG - Intergenic
1082983830 11:59149035-59149057 ATTTGAGCATTCATGGATTTTGG - Intronic
1083031276 11:59594927-59594949 ATGTGTGTGTGCCAGGAATTGGG + Intronic
1083812160 11:65112149-65112171 ATCTGAGGATGGAAGGCTTTGGG + Intronic
1084865589 11:72053998-72054020 ACTTGAGCATCCAAGGATTTTGG + Intronic
1085213562 11:74805897-74805919 ACTTAAGTATGCATGGATTTTGG + Intronic
1085665346 11:78410534-78410556 ATGTCAGTATGCAAGAATAAGGG + Intronic
1085984664 11:81770969-81770991 ATTTGAGCATGTATGGATTTTGG + Intergenic
1086018962 11:82202579-82202601 GTGTGAGTCTGCAGGGAGTTAGG - Intergenic
1086346517 11:85902770-85902792 ATTTGAGTGTGCTTGGATTTTGG - Intronic
1086408799 11:86522932-86522954 ATTTGAGCATCCATGGATTTTGG + Intronic
1087130118 11:94661829-94661851 ATATCAGTAGGCAAGGATGTGGG - Intergenic
1087902506 11:103657656-103657678 ATTTGAGCATTCATGGATTTTGG + Intergenic
1088050345 11:105506776-105506798 ATCTAAGTATCCACGGATTTTGG - Intergenic
1088747886 11:112819795-112819817 AAGTGAGTCTGAGAGGATTTGGG - Intergenic
1088860800 11:113797496-113797518 ATTTGAGTATGCATGGATTTTGG + Intergenic
1089029594 11:115311422-115311444 ACTTGAATATGCATGGATTTTGG - Intronic
1091004661 11:131942232-131942254 GTGTTAGTTTGCAGGGATTTAGG - Intronic
1093680557 12:21997259-21997281 ATCTGGGGATTCAAGGATTTTGG - Intergenic
1093686819 12:22065856-22065878 ACTTGAGTATGCACAGATTTTGG - Intronic
1094190223 12:27690260-27690282 ACTTGAGTATGTACGGATTTTGG + Intronic
1094267052 12:28571318-28571340 ATTTGAGAATGCAATGATGTGGG + Intronic
1095457800 12:42407641-42407663 ATTTGAGCATCCATGGATTTTGG - Intronic
1095529070 12:43163292-43163314 ATTTGAGTATGCTTGTATTTTGG + Intergenic
1096497175 12:52045359-52045381 ACTTGAGTATGCATGGATTTTGG + Intronic
1096568780 12:52505805-52505827 ACTTGCGTATGCCAGGATTTTGG + Intergenic
1097042215 12:56162663-56162685 AGATGAGGATGCAGGGATTTGGG - Intronic
1097354447 12:58585850-58585872 ATGTGAGTGTGTGTGGATTTTGG + Intronic
1098149443 12:67531103-67531125 ATGTGGCTAAGCCAGGATTTAGG + Intergenic
1098754486 12:74342066-74342088 ATGTGATTATGAAGGGATATAGG - Intergenic
1100006735 12:89903766-89903788 ATGTGTCTCTGCCAGGATTTTGG - Intergenic
1100183884 12:92116019-92116041 ATGTGAGAATGAAAGAATTTGGG - Intronic
1100222477 12:92520738-92520760 ATCTGGCTATGCAAAGATTTTGG + Intergenic
1100466288 12:94848787-94848809 ATTTGAGTCTGCATGAATTTAGG - Intergenic
1100864282 12:98839800-98839822 AGGTGAGCAAGCAAGGCTTTAGG - Intronic
1101527214 12:105542286-105542308 ATGTGAGGATGCAGGGATGGAGG + Intergenic
1102184828 12:110939802-110939824 ACTTGAGTATGCAAGGATTTTGG - Intergenic
1105793473 13:23827093-23827115 ACTTGAGCATCCAAGGATTTTGG + Intronic
1105982072 13:25527615-25527637 ATCTCAGGATGCAAGCATTTGGG + Intronic
1106261410 13:28070171-28070193 ACTTGAGTATCCATGGATTTTGG + Intronic
1106912009 13:34472880-34472902 ACTTGAGTATCCATGGATTTTGG + Intergenic
1107696495 13:43005283-43005305 GTGTGAATATGCGAGGTTTTGGG - Intergenic
1108480483 13:50865354-50865376 ACTTGAGTATGCTTGGATTTTGG - Intergenic
1108699241 13:52929785-52929807 ACTTGAGCATGCATGGATTTTGG + Intergenic
1108817508 13:54309713-54309735 AAGTGAGTATGCACAGACTTTGG - Intergenic
1110684470 13:78355659-78355681 ACTTGAATATTCAAGGATTTTGG - Intergenic
1111239996 13:85460787-85460809 ATGTGTGTATGCTGTGATTTTGG + Intergenic
1112571395 13:100596764-100596786 ATGTGAGTCAGGATGGATTTTGG + Intergenic
1113148457 13:107235443-107235465 AATTGAGTATTCATGGATTTTGG - Intronic
1114028546 14:18554276-18554298 AACTGAGTATGCGAGGATCTAGG - Intergenic
1114135322 14:19842206-19842228 ATTTGAGCATCCATGGATTTTGG + Intergenic
1114766956 14:25383832-25383854 ATGTGTGTATTCAAGAATCTGGG - Intergenic
1115929430 14:38474367-38474389 ATTTGAGGATCCATGGATTTTGG - Intergenic
1116594013 14:46817196-46817218 ATCTGTGTATTCAAGGATTGCGG - Intergenic
1116986686 14:51227465-51227487 ACTTGAGTATGCAAGGATTTTGG - Intergenic
1117056759 14:51920025-51920047 ACTTGAGTATCCATGGATTTTGG - Intronic
1118963430 14:70556804-70556826 ACTTAAGTATGCATGGATTTAGG + Intergenic
1119118530 14:72050847-72050869 ACTTGAGTATGCCTGGATTTTGG + Intronic
1120572126 14:86132714-86132736 TTTTGAGTATGAAAGCATTTGGG - Intergenic
1122605653 14:102945922-102945944 GATTGAGTCTGCAAGGATTTGGG + Intronic
1125202810 15:37115702-37115724 ATGTGAGTGGGAATGGATTTGGG - Intergenic
1125695876 15:41636871-41636893 ATTTGAGCATCCATGGATTTTGG + Intronic
1126808417 15:52377022-52377044 ATATGAATACCCAAGGATTTTGG - Intronic
1126899408 15:53297547-53297569 ACTTGAGTATCCATGGATTTTGG - Intergenic
1127435993 15:58958727-58958749 ACTTGAGTATGTAAGGATTTTGG + Intronic
1129226470 15:74173369-74173391 ATGTGTGTTTGCATGGATGTGGG - Intergenic
1129780630 15:78268139-78268161 ATGTGAGTATCCAGGGTATTTGG + Intronic
1129886152 15:79038807-79038829 ATGTGAGTATGTAAGCAGTTTGG - Intronic
1130180869 15:81626976-81626998 ATGTGATTATGGAACGATATAGG + Intergenic
1131164446 15:90132164-90132186 ACTTGAGCATGCATGGATTTTGG - Intergenic
1131220391 15:90579253-90579275 ATTTGAGTATGCATAGATTTTGG + Intronic
1131596219 15:93800864-93800886 ACTAGAGTATGCAAGGATTTAGG + Intergenic
1131754833 15:95548564-95548586 ACTTGGGTATGCATGGATTTTGG - Intergenic
1131989908 15:98083126-98083148 ACTTGAGTCTGCAAGGACTTGGG + Intergenic
1132076771 15:98828046-98828068 ATGTGAAAAAGCAAGGCTTTAGG + Intronic
1132790665 16:1685369-1685391 TTGTCACTGTGCAAGGATTTTGG - Intronic
1133068557 16:3229169-3229191 ATTTGAGCATCCATGGATTTTGG + Intronic
1133710395 16:8395718-8395740 ATGTGTGTGTGCAGGGATTAAGG - Intergenic
1135577231 16:23595408-23595430 ACGTGAGTGTGCGGGGATTTGGG - Intronic
1138026514 16:53526428-53526450 ACTTGAGTATGCACAGATTTTGG - Intergenic
1140895956 16:79324445-79324467 ACTCGAGTATGCATGGATTTTGG + Intergenic
1140912289 16:79465175-79465197 ATTTGAGCATCCATGGATTTTGG - Intergenic
1141118416 16:81331693-81331715 ATGAGAGAATGCAAGGAGTTTGG - Intronic
1141287220 16:82683614-82683636 ATGTGAGCATTCATGGATTGAGG + Intronic
1142418507 16:89956155-89956177 ATGTAACTTTGAAAGGATTTGGG + Intronic
1142446733 16:90144297-90144319 ACTTGAGTATGCGTGGATTTTGG + Intergenic
1142449107 16:90163953-90163975 ACGTGAGTAAGCATGGATTTTGG + Intergenic
1142457988 17:67927-67949 ACGTGAGTAAGCATGGATTTTGG - Intergenic
1142458382 17:71345-71367 ACGTGAGTAAGCATGGATTTTGG - Intergenic
1142460772 17:91172-91194 ACTTGAGTATGCGTGGATTTTGG - Intergenic
1144406691 17:14958809-14958831 ACTTGAGTATGCTGGGATTTTGG - Intergenic
1144592807 17:16539009-16539031 ACTTGAGCATCCAAGGATTTTGG + Intergenic
1145829887 17:27907378-27907400 AAGTTAGAATGCAAGTATTTGGG - Intergenic
1149398136 17:56265669-56265691 ATTTGAGCATCCATGGATTTTGG - Intronic
1150168751 17:62968972-62968994 ATTTGAGCATGCAAGGATTTTGG - Intergenic
1150258713 17:63771362-63771384 ACTTGAGTATCCATGGATTTTGG + Intronic
1151636587 17:75353255-75353277 ACTTGAGTATGCACAGATTTGGG - Intronic
1151781425 17:76248773-76248795 ACTTGAGCATCCAAGGATTTTGG - Intergenic
1153369506 18:4298136-4298158 ACTTGGGTATGCACGGATTTTGG - Intronic
1153580257 18:6565906-6565928 GTGTGAGTATGCATGCATGTGGG + Intronic
1153780197 18:8488328-8488350 ATGTGGGTAACCAAGGATTTTGG - Intergenic
1154372641 18:13778388-13778410 ACTTGAGTATGCAGGGATTTTGG + Intergenic
1155134056 18:22970002-22970024 ACTTGAGCATCCAAGGATTTTGG - Intronic
1156198467 18:34803131-34803153 CTGGGGGTATGCAGGGATTTAGG - Intronic
1156734460 18:40236467-40236489 ATATGAATTTGCATGGATTTAGG + Intergenic
1157022775 18:43806395-43806417 ATTTGAGCATCCATGGATTTTGG + Intergenic
1157163060 18:45332451-45332473 AGTTGAGTATCCATGGATTTTGG + Intronic
1157366070 18:47065410-47065432 ACTTGAGTATGCACAGATTTTGG + Intronic
1157687453 18:49653850-49653872 ATGTATGTATGCAAGTATATGGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158377778 18:56890947-56890969 ATGTGAGTATCTGAGCATTTAGG + Intronic
1158809553 18:61016434-61016456 ACTTGACTATGCATGGATTTTGG - Intergenic
1159477732 18:68944604-68944626 GTGTCAGTATGCAAGGCTTTTGG - Intronic
1159786275 18:72718307-72718329 AGATGAATATGCATGGATTTAGG + Intergenic
1160648100 19:203854-203876 ACGTGAGTAAGCATGGATTTTGG - Intergenic
1160650473 19:223534-223556 ACTTGAGTATGCGTGGATTTTGG - Intergenic
1161518121 19:4708203-4708225 ATGTGAGGGTTTAAGGATTTTGG - Intronic
1162563540 19:11432141-11432163 ACTTGAGTATGGAAGGATTTTGG - Intronic
1162992793 19:14314233-14314255 GTGTGAGTGTGCAAGGCTGTGGG - Intergenic
1164987821 19:32661715-32661737 ATTTGAGTATGTATGGACTTGGG - Intronic
1166610423 19:44188588-44188610 ACTTGAGTATCCATGGATTTTGG + Intergenic
925338957 2:3120596-3120618 ACTTGAGTATGCACAGATTTTGG - Intergenic
925675525 2:6357611-6357633 ATGGGAATATGCAAGCATTTTGG - Intergenic
925914328 2:8593994-8594016 AGGCAAGTATGCAATGATTTGGG - Intergenic
926301405 2:11606097-11606119 ACTGGAGTATGCATGGATTTTGG - Intronic
926968766 2:18445104-18445126 ATGTGAATATGTAAGGATGAGGG - Intergenic
927198293 2:20563182-20563204 AGGTGAGGATGCAAGGACATGGG - Intronic
927280405 2:21300046-21300068 ACTTGAGTATGCACAGATTTTGG - Intergenic
927775451 2:25899380-25899402 TTGTGAGGAAGCAAGAATTTTGG - Intergenic
928297259 2:30094883-30094905 ACTTGAGCATACAAGGATTTTGG - Intergenic
929207945 2:39319479-39319501 ATTTGGGTATGCACGGAGTTTGG + Intronic
930289140 2:49471490-49471512 ACCTGAGTATGCACTGATTTTGG + Intergenic
930442082 2:51421277-51421299 ACTTGAGTATGCACGGATTTTGG + Intergenic
930484452 2:51994900-51994922 ATATGAGTAGGCTTGGATTTAGG + Intergenic
930537338 2:52659957-52659979 ATTTGAGTATGTGGGGATTTCGG - Intergenic
930783767 2:55250171-55250193 ACTTGAGTATGCCGGGATTTTGG - Intronic
931032678 2:58198466-58198488 ATTTGGGTATGCATGGATTTTGG + Intronic
931676135 2:64698103-64698125 AGGTAAGAAAGCAAGGATTTTGG - Intronic
931807122 2:65818100-65818122 ATGTGAGTGGGCAAAGATATTGG - Intergenic
931964022 2:67513723-67513745 ATTTGAGCATCCATGGATTTTGG + Intergenic
932454420 2:71838365-71838387 ACTTGAGTATTCATGGATTTTGG + Intergenic
932707464 2:74037873-74037895 TTGAGAGTAAGGAAGGATTTGGG + Intronic
933293240 2:80461120-80461142 ATGGGAGTAGGAAAAGATTTAGG - Intronic
933443381 2:82344348-82344370 ACTTGAGTATCCATGGATTTGGG + Intergenic
933929811 2:87138030-87138052 ACTTGAGCATGCAGGGATTTGGG + Intergenic
934001142 2:87713822-87713844 ACTTGAGCATGCACGGATTTGGG + Intergenic
935685599 2:105680038-105680060 AAGTGAGTCTGCAAGGTCTTAGG - Intergenic
936363127 2:111825370-111825392 ACTTGAGCATGCACGGATTTGGG - Intronic
937196861 2:120165350-120165372 ATTTAAGCATGCATGGATTTTGG - Intronic
937481414 2:122264056-122264078 ACTTGAGCATGCATGGATTTTGG - Intergenic
939336247 2:140832253-140832275 ATCTGAGTATGTGTGGATTTTGG + Intronic
939348666 2:141002467-141002489 ATGTGAGTATCCATGGATTTTGG - Intronic
939677949 2:145095663-145095685 ATCTGAGTGGGCAAGGCTTTTGG - Intergenic
939723521 2:145684904-145684926 ACTTGAGTATGCATGGGTTTGGG + Intergenic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
941158370 2:162006037-162006059 GTATGAGTATGCAGGGATCTGGG - Intronic
941220755 2:162777212-162777234 ACTTGAGTATGCTTGGATTTTGG - Intronic
941965705 2:171298500-171298522 ATCTCAGTATGCTAGGAATTAGG + Intergenic
942027945 2:171929026-171929048 ATGTGAGTATAAAAGTACTTTGG - Intronic
942083263 2:172421698-172421720 ATTTGAGTATGCATGGATTTTGG + Intergenic
942648670 2:178144022-178144044 ATTTGAGCATCCACGGATTTTGG - Intergenic
943477438 2:188375921-188375943 ACTTGAGTATGCACAGATTTTGG - Intronic
944171288 2:196781583-196781605 ATTTGAGTATCCAAGGATTTTGG + Intronic
945852891 2:215030746-215030768 AGTTGTTTATGCAAGGATTTTGG + Intronic
946149950 2:217757566-217757588 ATTTGAGCATCCATGGATTTTGG + Intergenic
946911012 2:224460776-224460798 AGATGAGCATGCATGGATTTGGG - Intergenic
947152124 2:227126248-227126270 ACGTGAGTATCCATGGATTTTGG + Intronic
1170326942 20:15166379-15166401 ATGTGAATATGCAAGAAGTTAGG + Intronic
1172300518 20:33846510-33846532 ATGTGTGTATGTATGTATTTTGG + Intronic
1172580398 20:36042891-36042913 ACTTGAGTATGTACGGATTTGGG + Intergenic
1172832612 20:37848861-37848883 ACGTGAGTCTGCAGAGATTTGGG - Intronic
1174491385 20:50899167-50899189 ACTTAAGTATGCAAGGATTTTGG + Intronic
1174839629 20:53889452-53889474 ACTTGAGTATACATGGATTTTGG - Intergenic
1174943169 20:54955017-54955039 ACTTGAGTATGCACGGATTTGGG - Intergenic
1175163999 20:57030137-57030159 ATGTGCCTTTTCAAGGATTTGGG + Intergenic
1175607572 20:60323515-60323537 ATGTGGATATGCAGGCATTTGGG - Intergenic
1176278600 20:64287868-64287890 ACGTGAGTAAGCATGGATTTTGG + Intergenic
1177041848 21:16122072-16122094 ATTTGATTATGCTGGGATTTGGG - Intergenic
1177515301 21:22142403-22142425 ATTTGAGCATCCATGGATTTTGG - Intergenic
1177790922 21:25721423-25721445 AAGTGTGTATGGATGGATTTGGG + Intronic
1177799608 21:25815203-25815225 ATTTGAGTATCCACAGATTTTGG - Intergenic
1178449852 21:32687864-32687886 ACTTGAGTATGCACAGATTTTGG + Intronic
1178745759 21:35248720-35248742 ATGTGAGCATCCACAGATTTGGG - Intronic
1178928761 21:36798210-36798232 ATGTGTGTGTGCAGGTATTTGGG + Intronic
1179065421 21:38020304-38020326 ATGTAAGTAAGCAAGAAGTTGGG + Intronic
1179096303 21:38318732-38318754 ATTTGAGTATCCTTGGATTTTGG - Intergenic
1179368460 21:40781592-40781614 ACTTGAGTATGCCTGGATTTTGG + Intronic
1180452667 22:15481326-15481348 AACTGAGTATGCGAGGATCTAGG - Intergenic
1181339527 22:22166671-22166693 ATGGGAGTATGCACGTGTTTTGG + Intergenic
1182615649 22:31587628-31587650 ACTTGAGTATCCATGGATTTTGG + Intronic
1182838975 22:33369247-33369269 ATCTGAGAATGTCAGGATTTTGG - Intronic
1182914235 22:34013504-34013526 ATTTGAGTATCCCAGAATTTTGG - Intergenic
1183128942 22:35814250-35814272 GCTTGAGTATCCAAGGATTTTGG - Intronic
1185113332 22:48916679-48916701 ATCTAAGTATGCAGGGATCTAGG - Intergenic
949153090 3:794005-794027 ATGGGAGCTTGGAAGGATTTTGG + Intergenic
949216336 3:1573341-1573363 ATTTGAGAATCCATGGATTTTGG - Intergenic
951082182 3:18465739-18465761 ACTTGAGTATACCAGGATTTTGG + Intergenic
951161446 3:19427679-19427701 TTCTGTGTATGCAAAGATTTTGG - Intronic
951227965 3:20142985-20143007 ATGTGACAATACAAGGAATTGGG + Intronic
951276612 3:20694952-20694974 AACTGAGTATTCATGGATTTTGG - Intergenic
952012995 3:28923088-28923110 ACTTGAGTATGCATGGATTTTGG - Intergenic
952564967 3:34644478-34644500 ATGTGAGCATTCATGGATTTGGG - Intergenic
952910390 3:38179647-38179669 ACTTGAGTATGCATGAATTTGGG - Intronic
952910392 3:38179673-38179695 ACTTGAGTATGCATGAATTTGGG - Intronic
953601702 3:44372161-44372183 ACCTGAGTATGCACAGATTTTGG + Intronic
953937983 3:47063045-47063067 ACTTGAGTATGCACAGATTTTGG - Intronic
954607222 3:51921541-51921563 ATGTTAATCTGCTAGGATTTGGG - Intergenic
955473469 3:59311873-59311895 ACTTGAGTATGCATGGATTTTGG - Intergenic
955719267 3:61864477-61864499 AACTGAGCATTCAAGGATTTTGG + Intronic
956654259 3:71534027-71534049 ACTTGAGTATGCACGGATTTTGG - Intronic
956677324 3:71748321-71748343 ACTTCAGTATGCATGGATTTGGG + Intronic
956735830 3:72237392-72237414 ACTTAAGTATGCATGGATTTTGG - Intergenic
957248970 3:77748712-77748734 ATGTAGGTTTCCAAGGATTTCGG + Intergenic
957849426 3:85787513-85787535 ACTTGAGTATGCCTGGATTTTGG - Intronic
958497538 3:94864173-94864195 ATGTGCCTAGGCATGGATTTGGG + Intergenic
959313835 3:104776826-104776848 ACTTGAGTATTCAGGGATTTTGG + Intergenic
959705284 3:109333582-109333604 ATTTCAGTGTGCAATGATTTGGG - Intronic
959853171 3:111114915-111114937 ACTTAAGTATGCACGGATTTGGG + Intronic
960077560 3:113505065-113505087 ATTTGAGTATGTGTGGATTTTGG - Intronic
960576347 3:119233531-119233553 ACTTGAGCATGCATGGATTTGGG + Intronic
960908802 3:122628129-122628151 AACTGAGTATGGAAGGATGTAGG - Intronic
961409585 3:126708966-126708988 ACTTGAGCATCCAAGGATTTTGG - Intronic
961536658 3:127574846-127574868 ATGTGTGTATGCATGCATGTGGG + Intronic
961983605 3:131107581-131107603 ACTTGAGTATGCGAGGATTCTGG - Intronic
962612036 3:137085939-137085961 TTGTTGGTATGCAATGATTTGGG + Intergenic
964123893 3:153216157-153216179 ACTTGAGTATGCACAGATTTTGG - Intergenic
964182064 3:153900484-153900506 ACTTGAGTATGCATGAATTTGGG + Intergenic
964365903 3:155950669-155950691 ACCTGAGTATGCGTGGATTTTGG + Intergenic
964504931 3:157388875-157388897 ATTTGAGTATCCTTGGATTTTGG + Intronic
964789033 3:160433492-160433514 ATTTGAGTGTGAAAGGAATTTGG - Intronic
964966425 3:162499153-162499175 ATTTGAGCATCCATGGATTTTGG - Intergenic
965210068 3:165773993-165774015 ACTTGAGTATGAGAGGATTTTGG - Intronic
967597408 3:191343140-191343162 AAGTGAGTATGCACCTATTTTGG + Intronic
968367359 3:198196451-198196473 ACTTGAGTATGCGTGGATTTTGG + Intergenic
968369747 3:198216261-198216283 ACGTGAGTAAGCATGGATTTTGG + Intergenic
970104896 4:12570649-12570671 ATGTGTGTATGAATGGATTATGG + Intergenic
970490493 4:16568649-16568671 CTCTGAGTATGCACAGATTTGGG - Intronic
971465654 4:26957053-26957075 ATTTGAGTATCCATGAATTTTGG - Intronic
972268803 4:37489037-37489059 AATTGAGTATGCATGGATTTTGG + Intronic
973133893 4:46682197-46682219 ACTTGAGTATGCACGAATTTTGG + Intergenic
973237961 4:47926465-47926487 AGTTGAGTATGCTTGGATTTGGG + Intronic
974335627 4:60540866-60540888 AATTGAGTATGCATGGATTTGGG + Intergenic
974406702 4:61481327-61481349 ATCTGAGGATGCCAGTATTTAGG + Intronic
974536036 4:63177064-63177086 ACCAGAGTATGCATGGATTTTGG + Intergenic
975573924 4:75844356-75844378 TTCTGATTATGCAAGGTTTTGGG - Intergenic
976393340 4:84528763-84528785 ACTTGAGTGTGCTAGGATTTTGG - Intergenic
976718479 4:88148227-88148249 ACTTGAGTATGCAGGGATTTGGG + Intronic
977424491 4:96850236-96850258 ATGTAAGTATGCATGTATGTAGG + Intergenic
977438383 4:97030864-97030886 ATGTGGGTATGGCAGGATCTTGG + Intergenic
977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG + Intronic
977698818 4:99997795-99997817 ACTTGAGTATGCATGGATTTTGG + Intergenic
978379496 4:108112050-108112072 ATCTGAGTATGCAAAGAGCTCGG + Intronic
978395860 4:108279254-108279276 AAGTGAATACCCAAGGATTTAGG - Intergenic
978961827 4:114688909-114688931 ATCTGTGTATGTTAGGATTTAGG + Intergenic
979258461 4:118628225-118628247 ACGTGAGTAAGCATGGGTTTTGG + Intergenic
979329893 4:119412331-119412353 ACGTGAGTAAGCATGGGTTTTGG - Intergenic
979332567 4:119434382-119434404 ACTTGAGTATGCGTGGATTTTGG - Intergenic
979964414 4:127060884-127060906 TCTTGAGTATGCATGGATTTTGG + Intergenic
981592531 4:146379985-146380007 GTGTGTGTATGCAAGAATATGGG + Intronic
981999398 4:151008464-151008486 ATCTGAGTATGCTCAGATTTTGG - Intronic
982421566 4:155204914-155204936 ACATGAATATGCAAGGATTTTGG - Intergenic
982704710 4:158694923-158694945 ACTTGAGTATGCATGAATTTTGG - Intronic
982971311 4:161991695-161991717 ACTTGAGTATGCATGGATTTTGG + Intronic
983442749 4:167808271-167808293 ACTTGAGTATGCATGAATTTGGG + Intergenic
983671256 4:170240512-170240534 ATTAGAATATGCAAGGTTTTTGG - Intergenic
983750047 4:171256734-171256756 ACTTGAGTGTGCACGGATTTTGG - Intergenic
983762077 4:171423437-171423459 ACATGAGTATGCACAGATTTGGG + Intergenic
984074163 4:175154022-175154044 ACTTGAGTATCCTAGGATTTTGG - Intergenic
986124911 5:4875848-4875870 ATGTGAGAAAGCAAGAATTATGG - Intergenic
986349465 5:6863937-6863959 ATTTGTGTAAGCCAGGATTTAGG + Intergenic
986369963 5:7070000-7070022 ATGTGAGTAGGCCAGGGATTAGG - Intergenic
989828541 5:45888230-45888252 AGGGCATTATGCAAGGATTTGGG + Intergenic
990467341 5:56082742-56082764 ACTTGAGTATGCACAGATTTTGG + Intergenic
990833359 5:59985769-59985791 AATTGAGTATGCATGAATTTTGG - Intronic
991179908 5:63738232-63738254 ACTTGAGTGTGTAAGGATTTTGG - Intergenic
991606241 5:68404157-68404179 ACTTGAACATGCAAGGATTTTGG - Intergenic
991724193 5:69519767-69519789 ACTTGAATATGCATGGATTTGGG - Intronic
992093748 5:73341485-73341507 ATGTGAGGATGCAAAGAAGTTGG - Intergenic
992201249 5:74386509-74386531 AAGTGGGAATGCAAAGATTTGGG + Intergenic
992979937 5:82158696-82158718 ATGTGACTTTTAAAGGATTTGGG - Intronic
993032186 5:82717415-82717437 ATTTTAGTATCCATGGATTTTGG - Intergenic
994113001 5:96028929-96028951 AGGTGAGCACGCCAGGATTTTGG + Intergenic
994187429 5:96830906-96830928 ATTTGAGTATACTTGGATTTTGG - Intronic
994954908 5:106515898-106515920 AGTTGAGTATCCATGGATTTTGG + Intergenic
995168248 5:109073710-109073732 ACCTGAGTATGCATGAATTTTGG - Intronic
995834845 5:116389724-116389746 ACTTGAGCATGCATGGATTTTGG + Intronic
996005649 5:118418178-118418200 ATTTGAGAATGCATGGATTTTGG + Intergenic
996524390 5:124462605-124462627 ATGATTGTAAGCAAGGATTTAGG + Intergenic
996730317 5:126711214-126711236 ATGTGAGTATCTAAAAATTTGGG - Intergenic
997307287 5:132847607-132847629 TTATGAGCAAGCAAGGATTTTGG - Intergenic
998023475 5:138791706-138791728 CTGTGAGTTTGCAAGCATCTGGG + Intronic
998072984 5:139213250-139213272 ACTTGAGTTTGCATGGATTTTGG + Intronic
998956229 5:147441341-147441363 ATGTGAGGACACAAGGATTAGGG - Intronic
999773307 5:154791682-154791704 ACTTGAGTATGCAAAGATTCTGG - Intronic
1001740223 5:174046963-174046985 ATAAGAGAATGAAAGGATTTGGG - Intronic
1002726584 5:181301672-181301694 ACTTGAGTATGCGTGGATTTTGG + Intergenic
1002729026 5:181321841-181321863 ACGTGAGTAAGCATGGATTTTGG + Intergenic
1002754525 6:147379-147401 ACGTGAGTAAGCATGGATTTTGG - Intergenic
1003205355 6:4004686-4004708 ATTTGAGCATCCAAGGATTTGGG - Intergenic
1003258382 6:4493912-4493934 ATGTGCATTTGCAAGTATTTTGG - Intergenic
1003900779 6:10653547-10653569 ACTTGAGTGTGCATGGATTTTGG - Intergenic
1004486713 6:16073094-16073116 ACCTGAGCATGCATGGATTTTGG - Intergenic
1005618325 6:27596666-27596688 ACTTGAGTTTGCATGGATTTTGG - Intergenic
1005635146 6:27746028-27746050 ACTTGACTATGCAGGGATTTTGG - Intergenic
1006315584 6:33289619-33289641 ACGTGAGTAGGTTAGGATTTCGG + Exonic
1006821238 6:36897295-36897317 ACTTGAATATGCAAGGATTTGGG - Intronic
1006972487 6:38060842-38060864 ACCTGAGTATGCACAGATTTTGG - Intronic
1007498545 6:42278751-42278773 ATGTGATCATGAAAGCATTTGGG - Intronic
1008955085 6:57206705-57206727 ATGTGAGTATGCAGGGATATGGG + Intronic
1009585709 6:65599052-65599074 ACTTGAGTATGCATGGATTTTGG - Intronic
1009608325 6:65903427-65903449 ATTTGAGTATGCCTGGATTATGG - Intergenic
1010261085 6:73817734-73817756 ATGTGAGCATCAAAGGATCTGGG - Intronic
1010720547 6:79278481-79278503 ACTTGAGCATCCAAGGATTTTGG - Intergenic
1010740342 6:79495406-79495428 ACTTGAGTATGCCTGGATTTTGG - Intronic
1010753623 6:79642362-79642384 ACTTGAGCATCCAAGGATTTTGG + Intronic
1011021757 6:82821519-82821541 ATGTGAGCATCCGTGGATTTTGG - Intergenic
1011135199 6:84092678-84092700 ACTTAAGTATGCTAGGATTTTGG - Intergenic
1012465210 6:99509883-99509905 ACTTGAGTATGCACAGATTTGGG - Intronic
1013137711 6:107298500-107298522 ACTTGAGCATCCAAGGATTTTGG + Intronic
1013150106 6:107437615-107437637 TCTTGAGTATGCATGGATTTTGG - Intronic
1013353685 6:109328807-109328829 ATTTGAATATGCATGGATTCAGG + Intergenic
1014125205 6:117769278-117769300 GTGTGTGTATGCAAGGAATAGGG - Intergenic
1014635869 6:123845699-123845721 CAGTGAGTCTGCATGGATTTTGG + Intronic
1014724120 6:124955335-124955357 ATGTGAAGATGCAGGGCTTTTGG - Intergenic
1014960752 6:127681424-127681446 ATTTGAGTAAGCATGGAGTTTGG + Intergenic
1015018041 6:128437949-128437971 ACTTTAGTATGCACGGATTTGGG - Intronic
1015018238 6:128440129-128440151 ACTTGAGTATACATGGATTTTGG + Intronic
1015416155 6:132950994-132951016 CTTTGAGTTTTCAAGGATTTAGG - Intergenic
1015670344 6:135681950-135681972 ACTTAAGTATGCATGGATTTGGG - Intergenic
1017782275 6:157724901-157724923 ACGTGAGTATCCAAGGATTTTGG + Intronic
1017853451 6:158326990-158327012 ATTTGAGTATGTGAGAATTTGGG + Intronic
1018654420 6:166020222-166020244 ATGTGAGTATGCAAGGGACCTGG + Intergenic
1019118004 6:169780927-169780949 ACTTGAGTATGCTTGGATTTTGG + Intronic
1019205284 6:170356582-170356604 ACTTGAGGATGCATGGATTTTGG - Intronic
1019340142 7:505043-505065 TTCTGAGTATGCCAGGATTCCGG + Intronic
1022800441 7:33771861-33771883 ATGTGAGTACACGAAGATTTTGG - Intergenic
1023011331 7:35927087-35927109 ATGTGAATATTCCAGGAGTTTGG - Intergenic
1023400440 7:39789543-39789565 ACGTGAGTAAGCATGGATTTTGG + Intergenic
1023441647 7:40190798-40190820 ACTTGAGTATGCACAGATTTTGG - Intronic
1023798775 7:43815033-43815055 ATGTGAGTAGAGAAGGACTTTGG - Intergenic
1024071472 7:45789290-45789312 ACTTGAATATGCATGGATTTTGG + Intergenic
1024073373 7:45805288-45805310 ACGTGAGTAAGCATGGATTTTGG + Intergenic
1024079813 7:45846816-45846838 ATGTGAATATTCCAGGAGTTTGG + Intergenic
1024649959 7:51394904-51394926 ACGTGAGTAAGCATGGATTTGGG - Intergenic
1025054106 7:55750576-55750598 ACGTGAGTAAGCATGGATTTTGG - Intergenic
1025124966 7:56337172-56337194 ATGTGAATATTCCAGGAGTTTGG - Intergenic
1025132155 7:56380719-56380741 ACGTGAGTAAGCATGGATTTTGG - Intergenic
1025134808 7:56402446-56402468 ACTTGAGTATGCGTGGATTTTGG - Intergenic
1025173488 7:56782652-56782674 ACTTGACTATGCCAGGATTTTGG + Intergenic
1025698615 7:63795519-63795541 ACTTGACTATGCCAGGATTTTGG - Intergenic
1025911923 7:65835957-65835979 ATGTGAGTATGCATGGATTTTGG + Intergenic
1025977721 7:66382216-66382238 ACGTGAGTATGCATGGATTTTGG - Intronic
1027203358 7:76077085-76077107 ATGTGAGTATGCATGGATTTTGG - Intergenic
1027339100 7:77186748-77186770 CTGTGAGTCTGCTATGATTTTGG - Intronic
1028089517 7:86680867-86680889 ATGTGGGCAGGCCAGGATTTAGG - Intronic
1028207753 7:88035755-88035777 ACTTGAGTATCCATGGATTTTGG + Intronic
1028334626 7:89636598-89636620 ATGTGAGGATGTAGGGACTTTGG + Intergenic
1028617573 7:92786276-92786298 ATGTGATTATGAAAGGTTTTTGG - Intronic
1028736182 7:94215142-94215164 ATGTGAGTTTGCAAATATGTTGG - Intergenic
1030010945 7:105166785-105166807 AGGTGAGTATGGAAACATTTTGG - Intronic
1030543761 7:110866805-110866827 ATGTGTGTATGCTTAGATTTAGG - Intronic
1032048101 7:128626866-128626888 ACTTGAGTATGCATGGATTTTGG + Intergenic
1032050760 7:128648981-128649003 ACGTGAGTAAGCATGGATTTTGG + Intergenic
1032158472 7:129490780-129490802 ACTTGAGCATCCAAGGATTTTGG + Intergenic
1034097405 7:148422832-148422854 ACGTGAGCATCCATGGATTTTGG + Intergenic
1035328649 7:158082352-158082374 ATGTGAGGTTGAAAGGATTTTGG - Intronic
1035438891 7:158879359-158879381 ACTTGAGTATTCATGGATTTTGG - Intronic
1037483751 8:19328499-19328521 ATGACAGTATTCAAGAATTTAGG - Intronic
1040492694 8:47939268-47939290 ACTTGAGTATGCATGGATTTAGG - Intronic
1041276358 8:56163077-56163099 GTGTGAGTGTGGAAGGATCTTGG - Exonic
1041766941 8:61428728-61428750 ATTTAAGTATGCACAGATTTAGG - Intronic
1044734252 8:95262175-95262197 ACTTGAGTATGTATGGATTTTGG + Intronic
1045769667 8:105721124-105721146 ACTGGAGTATGCATGGATTTTGG - Intronic
1046825173 8:118682054-118682076 ACTTGAGTATGCATGGATTTTGG + Intergenic
1047021883 8:120784315-120784337 ATTTGAGTATCCAATGATTATGG + Intronic
1049837024 8:144742817-144742839 ACTTGAGTATGCATGGATTTGGG - Intronic
1050188419 9:2999242-2999264 ACTTGAGCATCCAAGGATTTGGG - Intergenic
1050908395 9:11035365-11035387 ATGTGATTTTGCATAGATTTTGG - Intergenic
1051773624 9:20609342-20609364 ATGTATGTATGCAAGTATGTTGG + Intronic
1052463966 9:28805822-28805844 AGGTCAGTATGCATGGGTTTTGG + Intergenic
1052479519 9:29005651-29005673 ATTTGAGTATGCATGAATTTTGG - Intergenic
1053089671 9:35263414-35263436 ATTTGAGTATGCACGGATTTTGG - Intronic
1054965339 9:71019964-71019986 ATGTGAGTATCCAACCAATTTGG - Intronic
1056775315 9:89508019-89508041 ACTTGAGTATGCGTGGATTTTGG - Intergenic
1057040579 9:91844843-91844865 ATGGGAGCATGCAAGGACCTGGG - Intronic
1059189549 9:112311597-112311619 ACTTGAGTATGCATGGATTTTGG + Intronic
1059521997 9:114951471-114951493 CTGTGAGTATGGAGGGTTTTAGG + Intergenic
1060503298 9:124179472-124179494 AACTGAGCATGCAAGGATGTAGG + Intergenic
1060778540 9:126394569-126394591 ATGTTACTTTGCAAGGGTTTGGG + Intronic
1061266108 9:129505913-129505935 ATGAGAGTATGCAACCTTTTGGG - Intergenic
1062751714 9:138259300-138259322 ACTTGAGTATGCGTGGATTTTGG + Intergenic
1203576607 Un_KI270745v1:13719-13741 ACGTGAGTAAGCATGGATTTTGG + Intergenic
1186433146 X:9521587-9521609 ATTTGAGTGTGCAATCATTTGGG - Intronic
1186975995 X:14905412-14905434 ACTTGAGCATCCAAGGATTTTGG - Intronic
1187284782 X:17894546-17894568 ATGAGAGAATGCAGTGATTTGGG - Intergenic
1187846007 X:23538592-23538614 ACTTGAGTATGCACGGATTTTGG - Intergenic
1188704654 X:33312336-33312358 ATGTGAGTATGTTCAGATTTTGG + Intronic
1189404725 X:40710916-40710938 ACGTGAGTTTGCGTGGATTTTGG - Intronic
1189763803 X:44348643-44348665 ACTTGAGTGTTCAAGGATTTTGG + Intergenic
1189831322 X:44976435-44976457 ACTTGAGTATCCATGGATTTTGG - Intronic
1190475889 X:50827094-50827116 ACCTGAGTATGCACGGATTTTGG + Intergenic
1192609508 X:72553662-72553684 ATTTGAGTGTGCATGGATTTTGG - Intronic
1192784115 X:74321223-74321245 ATGTGTGTGTGCTAGGATCTGGG - Intergenic
1193730532 X:85097212-85097234 ACTTGAGTAGGCATGGATTTGGG + Intronic
1195035760 X:100970594-100970616 ATTTGAGAATGCACAGATTTTGG - Intronic
1195457916 X:105090243-105090265 ACTTGAATATGCAAGAATTTGGG - Intronic
1195570053 X:106389068-106389090 GTGTGTGTATGTAAGCATTTAGG + Intergenic
1196094140 X:111780550-111780572 ACTTGAGTATGCATGGATTTTGG - Intronic
1196212572 X:113011770-113011792 ACTTGAGTATACATGGATTTTGG - Intergenic
1196331350 X:114472901-114472923 TTGTGAATATGCAAGAATTCAGG + Intergenic
1196656470 X:118223213-118223235 ACTTGAGTATGCAAGGATTTGGG - Intergenic
1196885053 X:120236531-120236553 GCTTGAGTATGCATGGATTTTGG - Intergenic
1197771610 X:130092903-130092925 ACTTGAGTGTGCATGGATTTTGG - Intronic
1197848933 X:130836045-130836067 ATGACAGTCTGCAAGTATTTTGG + Intronic
1199435396 X:147806642-147806664 ATTTGAGCATCCACGGATTTTGG + Intergenic
1199689215 X:150295018-150295040 ACATGAACATGCAAGGATTTTGG + Intergenic
1199699768 X:150366356-150366378 ATGTGTGTATGCGCGCATTTGGG - Intronic
1200341721 X:155404043-155404065 ATTTGAGTATGCATGGATTTGGG - Intergenic
1200750926 Y:6943468-6943490 ATTTGAGTGTGCATGCATTTGGG - Intronic