ID: 917076183

View in Genome Browser
Species Human (GRCh38)
Location 1:171207467-171207489
Sequence CTGGAAAAGGGAAGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917076183_917076186 -10 Left 917076183 1:171207467-171207489 CCAGACACACTTCCCTTTTCCAG 0: 1
1: 0
2: 2
3: 21
4: 282
Right 917076186 1:171207480-171207502 CCTTTTCCAGCCTCTTCTCTTGG 0: 1
1: 0
2: 4
3: 55
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917076183 Original CRISPR CTGGAAAAGGGAAGTGTGTC TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900811379 1:4803872-4803894 CTGGAAGAAGGAAAAGTGTCAGG - Intergenic
901171673 1:7262950-7262972 CAGGAAAAGGCAAGTGTGATCGG - Intronic
901216188 1:7556646-7556668 CTGCAAGAGGCCAGTGTGTCTGG - Intronic
901575253 1:10195594-10195616 ATGGTAAAGAGAAATGTGTCAGG - Intergenic
901943650 1:12683539-12683561 CTGGAAGAGGCCAGTGTGGCGGG + Intergenic
902138843 1:14334607-14334629 CAGGAAAAGGGAAGTCAGGCAGG + Intergenic
902601119 1:17540512-17540534 CTGGAACAGGGATATATGTCAGG + Intronic
903572145 1:24313870-24313892 CTGGAAATGGGAAGTGGCTGAGG + Intergenic
905945809 1:41900742-41900764 CAGGAAAAAGGAAATGTGTGTGG + Intronic
907060259 1:51415306-51415328 ATGAAAAAGGGCAGTGAGTCTGG - Intronic
907201674 1:52732182-52732204 CTTGAAAAAGGATGTGTGTAGGG + Intronic
907325498 1:53635975-53635997 CTGGAAAAGCCAACTGGGTCTGG - Intronic
907688023 1:56633131-56633153 CTGGAAAATGGAAATGAGTATGG + Intronic
909155855 1:72075733-72075755 CTGGAAAGTGGAAATGTGCCTGG + Intronic
910311012 1:85824661-85824683 CTTGAAAAGGGAAATGTGGTAGG - Intronic
910979965 1:92950284-92950306 CTGGAAACTGGAAGTTTTTCAGG + Intronic
911076113 1:93877191-93877213 TTGTAAATGGGAAGTTTGTCTGG + Exonic
912521678 1:110250130-110250152 CGGGAAAGGGGAGCTGTGTCTGG - Intronic
913663036 1:121021478-121021500 CTGGAAAAGGAAGGAGTGTGAGG + Intergenic
913995676 1:143650486-143650508 AAGGAAAAGGGAAGCGTGTGGGG + Intergenic
914014419 1:143804743-143804765 CTGGAAAAGGAAGGAGTGTGAGG + Intergenic
914163400 1:145156458-145156480 CTGGAAAAGGAAGGAGTGTGAGG - Intergenic
914449994 1:147782827-147782849 GTGGACAAGGGAAGTGAGACTGG + Intergenic
915301624 1:154954913-154954935 CAGGAAAAGGGAAGTGAGGCTGG + Intronic
915570211 1:156741219-156741241 CTGGAAACAGGAAGTTTGGCGGG + Intronic
916394843 1:164374635-164374657 CTGCAAAAGGCCAGTGTGTCAGG - Intergenic
916845327 1:168644460-168644482 CTGGTAAAGGGAAGTTTGGATGG + Intergenic
917076183 1:171207467-171207489 CTGGAAAAGGGAAGTGTGTCTGG - Intronic
918690689 1:187475476-187475498 CTGGAAAAGGGAAGAGGATAGGG + Intergenic
921127802 1:212193451-212193473 CTGGAAAAGGAAAATGTGTGTGG - Intergenic
921146944 1:212367357-212367379 TTGGGAGAGGGAAGTGAGTCTGG + Intronic
921452621 1:215326161-215326183 CTGGATAAGGGAAGAGAATCTGG + Intergenic
923261163 1:232269329-232269351 TTGGAAGATGGAAGTGTGGCAGG + Intergenic
923328734 1:232902975-232902997 CTCGAAATGGGAAGGGGGTCGGG + Intergenic
923463202 1:234225077-234225099 CTGGAAAGGGCAAGTGGGTTGGG + Intronic
924565887 1:245198070-245198092 CTGCAAAAGGGAAGGATGTGTGG - Intronic
1063973201 10:11395888-11395910 CAGGAAAAGTGAAGTCTGCCAGG + Intergenic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1067264266 10:44723689-44723711 TAGGTCAAGGGAAGTGTGTCAGG + Intergenic
1067695948 10:48535873-48535895 CTGAGAAAGGGAAGGGTGTCGGG - Intronic
1067741114 10:48896824-48896846 CTGGACAAGGTAACTGAGTCAGG - Intronic
1067926147 10:50510103-50510125 CTGGAAAAGGCAAGAGTATAGGG - Intronic
1069757166 10:70780374-70780396 CACCAAAAGGGAAGTGTTTCAGG - Intronic
1071226020 10:83528394-83528416 CTGGAAAGGGGAAGTATATATGG + Intergenic
1072747081 10:97948287-97948309 CTGGAAAAAGCAAGTGTATTTGG + Intronic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074124056 10:110514269-110514291 CTGGAGAAGGGGATTGTGTGGGG - Intergenic
1074228685 10:111512643-111512665 CTGGAAAAGGGTTCTGGGTCTGG + Intergenic
1074712170 10:116186259-116186281 TTGGAAAAGGCAAGGTTGTCTGG - Intronic
1074754984 10:116617813-116617835 CAGGGAAAGGGGAGAGTGTCAGG + Intergenic
1075897877 10:126013671-126013693 CTGGGAAAGGGGCTTGTGTCTGG + Exonic
1075961559 10:126571622-126571644 CTTGAAAGGAGAAGTGTCTCCGG + Intronic
1077165482 11:1133646-1133668 CTGGAAAAGGGAAATAAGTGAGG + Intergenic
1077798380 11:5514851-5514873 CAGGAACAGGGCACTGTGTCAGG + Exonic
1079927488 11:26512819-26512841 CTGGAAGAGGGTGCTGTGTCAGG - Intronic
1080112512 11:28584139-28584161 CTGGAAAATGGATGTGAGTCGGG - Intergenic
1080583228 11:33660167-33660189 CTGGCAAAGGGAATACTGTCTGG + Intronic
1080738292 11:35039027-35039049 CTGGAAAATGAAGGTGTGGCGGG + Intergenic
1081779281 11:45698909-45698931 CTGCAAAAGGGAAGGATGCCTGG + Intergenic
1081846026 11:46241070-46241092 CTGGAAAAGGGAGGGGTCTGAGG - Intergenic
1082823532 11:57561219-57561241 CTGGAGAAGGGAAATGACTCCGG + Intronic
1083098178 11:60274612-60274634 CTGTAACAAGGAAGTGTGACTGG - Intergenic
1083190356 11:61047457-61047479 GTGCAAAAGTGAAGTGTGCCTGG - Intergenic
1084481702 11:69425029-69425051 CTGGAAAAGGCAAGACTGTAGGG + Intergenic
1084977233 11:72808494-72808516 CTGGAAAAGAGAAATGGGTGTGG - Intergenic
1085328020 11:75623481-75623503 CTTGCAAAGGGAGGGGTGTCAGG - Intronic
1088815042 11:113415010-113415032 CAGGAAAAGTGATGTGTGTTTGG + Intronic
1089045667 11:115500948-115500970 CTGGTAAAGGGGAGTGGGACAGG - Intronic
1089602001 11:119622128-119622150 CTTGAGAAGAGAAGTGTGTATGG + Intergenic
1091883587 12:3999794-3999816 CTGGAAACAGGAAGTTTGTTTGG - Intergenic
1092205234 12:6610787-6610809 CAGGAAAAGGGAAAAGTGACAGG - Intergenic
1093778769 12:23109246-23109268 CTGGAGAAAGGAAGCATGTCGGG - Intergenic
1095881271 12:47139433-47139455 CAGGAAAAGAGAAGTTTTTCAGG + Intronic
1097227047 12:57483655-57483677 GTGGAGAAGGGACGTGTTTCAGG - Intronic
1097267439 12:57754616-57754638 CTGGGAAAGAGAGGTGTGTAAGG - Intronic
1098496170 12:71137643-71137665 ATTTAAAAGGGTAGTGTGTCTGG - Intronic
1098546951 12:71721960-71721982 CTGCAAAAGGGAGGGGAGTCTGG - Intergenic
1099954953 12:89344696-89344718 CTGGGAGAGGGAGGTGGGTCAGG - Intergenic
1106406838 13:29481809-29481831 CTCAAACAGGGAGGTGTGTCTGG - Intronic
1107792554 13:44016868-44016890 CTGGAAAATGCAACTGTGTGGGG + Intergenic
1108258248 13:48631120-48631142 ATGGAAGAGGGAAGTGTGTTTGG - Intergenic
1108756560 13:53510154-53510176 CTGGCAATTGGAAGTCTGTCAGG + Intergenic
1109272711 13:60272331-60272353 GTAGAAATGGGAAGTGTGTGGGG - Intergenic
1109358498 13:61266097-61266119 CTTGATAAGGAAAGAGTGTCAGG - Intergenic
1110476247 13:75917400-75917422 CTAGAAAAGGGAAGTGAGAAGGG - Intergenic
1110646244 13:77888268-77888290 CTGTGAAAGGTATGTGTGTCAGG - Intergenic
1110728103 13:78849610-78849632 GTGGAAATCGGAAGTGTGTGAGG + Intergenic
1110884329 13:80614206-80614228 CTCAAAAAGGGAAGGGTGGCGGG - Intergenic
1111102481 13:83606178-83606200 GTGGCAAAGGGTGGTGTGTCAGG - Intergenic
1113331917 13:109335682-109335704 CTGAAAAGATGAAGTGTGTCAGG + Intergenic
1113523353 13:110955659-110955681 CTGGAAGAGGAAAGAGTGGCTGG - Intergenic
1113701953 13:112394837-112394859 CTGGAAGAGGAAAGAGTGGCTGG + Intronic
1114197714 14:20493721-20493743 CAGGAAAAGGCCAGTGTGTGGGG + Intergenic
1114300175 14:21368905-21368927 CTGGTAAGGGTAAGTGTGTAGGG + Intronic
1114798396 14:25742551-25742573 CTGGAAAGGGTGAGTGTGTTGGG + Intergenic
1115464367 14:33698660-33698682 CTGAGGAAGGGAAGTATGTCAGG - Intronic
1118505130 14:66402906-66402928 CTGGAATTGGAAAGTGAGTCTGG - Intergenic
1118981927 14:70724189-70724211 CTGGAGAAGGGAAGTGATTATGG - Intronic
1120739553 14:88092540-88092562 CTGGACAAGGGAAGTGTGTGAGG + Intergenic
1121835812 14:97091184-97091206 CAGGAAAGGGGAAAAGTGTCTGG + Intergenic
1128948236 15:71846599-71846621 ATGGGAAAGGGAAGTTTGACAGG + Intronic
1128988293 15:72237145-72237167 GTGGAGAGTGGAAGTGTGTCAGG - Intergenic
1129479416 15:75811158-75811180 CTGTCAAAGAGAAGTGTTTCTGG - Intergenic
1130376959 15:83337878-83337900 CTGGAAAGAGGAAGTGTCTCTGG + Intergenic
1130725392 15:86433565-86433587 CTTGGAGAGAGAAGTGTGTCAGG + Intronic
1130924600 15:88375616-88375638 CTGGAAGAGGGAAATGAGTGAGG - Intergenic
1133704631 16:8342044-8342066 CTGGAAGAGGGAAGTATAGCAGG - Intergenic
1133775072 16:8889411-8889433 CTGGAACAGGGAGGTGAGGCGGG + Intergenic
1135223698 16:20637272-20637294 CTGGAGCAGGGAAGTGCGGCTGG + Intronic
1135967144 16:27045493-27045515 CCTGAAAAAGGAAGTGTGTGTGG - Intergenic
1139499339 16:67348873-67348895 CTGGGAAAGGGAAGGATCTCAGG - Intronic
1139552586 16:67683365-67683387 CTGGAAAGGTGAGGTGTGTCCGG - Intronic
1140924727 16:79571318-79571340 TTGGAAAATGAAAGTGTATCTGG - Intergenic
1141025224 16:80540795-80540817 AGGGAAGAGGGAAGTGGGTCAGG - Intronic
1141099638 16:81187866-81187888 CTAGAAGGGGGAAGTGAGTCAGG - Intergenic
1142182731 16:88679080-88679102 CCTGTAAAGGGAAGTGTGACTGG + Intronic
1142970224 17:3606385-3606407 GTGGCAAAGGGAAGGGTGTGTGG + Intergenic
1143037515 17:4007818-4007840 CTGCAAAAGGGCGGTGTGTTCGG + Intronic
1143128843 17:4663384-4663406 CTGGACAAGGGTTGTGTGTTAGG - Intergenic
1143564989 17:7715845-7715867 CTGGGACAGGGATGTGTGTGGGG + Intergenic
1144934938 17:18890092-18890114 CTTAAAAAAGGAAGTATGTCTGG - Intronic
1145056900 17:19708660-19708682 CTGGAATAGGGCAGTGTGCTGGG + Intronic
1146722381 17:35132452-35132474 GTGGAGAAGGGAAGGGTGTCAGG + Intronic
1147369792 17:39984476-39984498 CTGGAAGAGGTGAGTGAGTCAGG + Exonic
1148476640 17:47933043-47933065 CTAGGAAAGGTCAGTGTGTCAGG - Intergenic
1149237473 17:54609630-54609652 AAGGAAAAGGGAAATGTGACAGG + Intergenic
1150282965 17:63940188-63940210 CTGGAAAAGGGAAATGTGACTGG - Exonic
1151613344 17:75191473-75191495 TTGGAAAAAGAAAGTGGGTCTGG + Intergenic
1153055267 18:939630-939652 CTGAAAAAGGGAAGTTTGGTGGG + Intergenic
1153301658 18:3597026-3597048 CAGGAAAAGGGCAGTGTCACAGG - Intronic
1157096573 18:44690702-44690724 CTGTAAAATGGATGTGTCTCTGG + Intronic
1158418937 18:57275512-57275534 CTGGAGGAGGGAGGTCTGTCTGG - Intergenic
1159378734 18:67628932-67628954 CTTGAAAAGGGCAAAGTGTCTGG + Intergenic
1160600790 18:80010986-80011008 CTGGAAAGGGGCATTGTGTGGGG + Intronic
1160982522 19:1822904-1822926 CTGGGAAAGGTCTGTGTGTCTGG - Intronic
1161771150 19:6231353-6231375 CTGGAAAAGGGCTGTGAGTGAGG + Intronic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1162660247 19:12163198-12163220 CAGGAAATGGTGAGTGTGTCGGG + Exonic
1163028099 19:14525599-14525621 CTGGAAAAGGCAAAAGTATCAGG + Intronic
1165342713 19:35224335-35224357 CTGGAAAAGTGGCGCGTGTCTGG + Intergenic
1165562213 19:36689543-36689565 CATGAGAAGGGAAGTGTATCTGG - Intronic
1165830959 19:38729930-38729952 CTGGCAATGGCAAGTGAGTCTGG - Exonic
1166131855 19:40750434-40750456 CTGGAAAAAGGAAAGGAGTCAGG + Intronic
1168495108 19:56840938-56840960 CTGGAAAAGGGGGGTGGGTTGGG + Intergenic
925672410 2:6325551-6325573 CGGGCAAAGGGAAGTGTCCCTGG + Intergenic
925908246 2:8552491-8552513 CAGGAAAAGGGAAACTTGTCGGG - Intergenic
926670845 2:15575532-15575554 CTTGAAAAGGGAGGAGAGTCTGG - Intergenic
927041790 2:19237609-19237631 AGGGAAGAGGGCAGTGTGTCTGG - Intergenic
927043710 2:19255805-19255827 CTGGAAAAGGAAAATGCTTCTGG - Intergenic
927252414 2:21008725-21008747 CTGGTAAACGGAAGTCTGGCAGG + Exonic
927930784 2:27042299-27042321 CTGAAAAAGCGGAGTGTCTCAGG - Intergenic
928332674 2:30369720-30369742 TTGGAAAAGGGACGTGTTTAAGG - Intergenic
928941038 2:36727520-36727542 CTGGAAAATGGAGATTTGTCAGG + Intronic
929080912 2:38121244-38121266 CTGGAAGTGGGAAGTGGGGCTGG - Intergenic
929192605 2:39153658-39153680 ATGGAAAAGAAAAGTATGTCAGG - Intergenic
929816113 2:45233026-45233048 CTGCAAAAGGGAAGTGGGAAAGG - Intergenic
931894660 2:66715797-66715819 CTGGACAGGGGAATGGTGTCAGG - Intergenic
932172356 2:69568681-69568703 CTGGAAAAAGTAGTTGTGTCTGG - Intronic
932454157 2:71835578-71835600 ATGGGAATGGGAAGTGTGTTAGG - Intergenic
935810756 2:106794769-106794791 CTGGAAAAGAGACATGCGTCAGG - Intergenic
935977772 2:108596056-108596078 CTGCTAAAAGGATGTGTGTCAGG + Intronic
936135388 2:109888585-109888607 CTGCTAAAAGGATGTGTGTCAGG + Intergenic
936209309 2:110482900-110482922 CTGCTAAAAGGATGTGTGTCAGG - Intergenic
937115955 2:119405104-119405126 CTGAAACAGGGAACTGTGTGTGG + Intergenic
937608501 2:123830850-123830872 CTGGAAAACGTAAAAGTGTCTGG - Intergenic
939715105 2:145574086-145574108 CTGGCAAAGGGAAGTCCGTTGGG + Intergenic
944110249 2:196124230-196124252 CTGGAGAGGGGAATTGTGTGGGG + Intergenic
944587192 2:201182829-201182851 TTTGAAAAGTGAAGTGTGTTTGG + Intergenic
944723001 2:202442263-202442285 CTGGGATAGGGGAGTGTGTGTGG - Intronic
945066038 2:205948606-205948628 ATGGGAAAGGGAAGTGTGACCGG + Intergenic
945176892 2:207052278-207052300 CTGGAAAAGGGAAGGAGATCAGG + Intergenic
945459255 2:210085224-210085246 CTAGAAAAAGAAAGTGTGTCAGG + Intronic
945768023 2:214004214-214004236 CTGCAGAAGGGAAGAGGGTCTGG + Intronic
946352152 2:219162205-219162227 CTGCAAAAGAGAGGTTTGTCAGG + Intronic
946976584 2:225159580-225159602 TTGGGAAAGGGAAATGTGTTAGG + Intergenic
1169744712 20:8931934-8931956 CTGGAAAAGAGAAGGGTGGATGG - Intronic
1170113812 20:12835567-12835589 CTGGAGATGGGAAGTCTGTATGG - Intergenic
1170140491 20:13121268-13121290 CTGGAGAAGGGAACTGGGACAGG + Intronic
1170464336 20:16609221-16609243 TTTGGAAAGGGAAGTGTGTTAGG + Intergenic
1172878459 20:38180976-38180998 CTGGAAAAGGAATGTGTAACAGG - Intergenic
1174733663 20:52942981-52943003 CTGGAAAAGTGGAATGTGTGAGG - Intergenic
1175529241 20:59662774-59662796 CTGGAAATGGGGAGTGGGTGAGG + Intronic
1175625670 20:60486638-60486660 CTGGGGAAGGGAAGTGTTTAGGG + Intergenic
1175768833 20:61610149-61610171 CTGGGAAAGTGGAGTGTGTCTGG - Intronic
1177751679 21:25292754-25292776 CTGGAAAATGAGAGTGTGTAGGG - Intergenic
1179301758 21:40118186-40118208 TTGGAAAAAGGAATTGTGACAGG + Intronic
1182759953 22:32714338-32714360 CTGTAAAATGGGAGTTTGTCTGG + Intronic
1183064172 22:35352358-35352380 CTGCGAAAGAGCAGTGTGTCTGG - Intergenic
1185325806 22:50225360-50225382 CTGGGAAGGGACAGTGTGTCAGG - Intronic
951134085 3:19083455-19083477 GTAGAAAAGGGAAGGGTCTCTGG + Intergenic
951891512 3:27572192-27572214 CTGGCCAAGGGAAGAGTGTATGG - Intergenic
952308557 3:32167195-32167217 CTGGAAAGGTCAAGTGAGTCTGG + Exonic
952834494 3:37591711-37591733 CTGGATTAGGGAAATGTCTCTGG + Intronic
953688688 3:45098643-45098665 ATGGGAATGGGAAGTGTGTGTGG - Intronic
954753291 3:52825705-52825727 CTGGGAAAGGGAATAGTTTCAGG + Intronic
957558331 3:81788668-81788690 TTGGAGAAGGGAAGTGGGTAGGG - Intergenic
961502730 3:127349587-127349609 CTGGAAAAGGAGACTGGGTCTGG + Intergenic
963837413 3:150071054-150071076 CTGGACAAGGGGAGAGTGGCAGG + Intergenic
964217674 3:154305474-154305496 TTTGAAAAGGCAAATGTGTCAGG + Intronic
965531101 3:169771639-169771661 CAGGAAAAGTGAAGTTTATCAGG + Intergenic
967233072 3:187359244-187359266 CTGGAAGAGGGAAGGGTGATAGG - Intergenic
967881582 3:194305539-194305561 CTGGCTGAGGGAAGTGTGGCAGG - Intergenic
968056031 3:195692474-195692496 CTGGAAAAAGGAAAAGTGACTGG + Intergenic
972017064 4:34261010-34261032 CAGAAAAAGGGAACTGTGTGTGG - Intergenic
973121748 4:46529679-46529701 ATGGAACAGGGAAGTGTGAGTGG - Intergenic
973251731 4:48067706-48067728 CTGGAAAAGGGAAGTGGGGGTGG + Intronic
975235352 4:71989302-71989324 CAGGAAAAGGGAAATATCTCTGG + Intergenic
979099904 4:116600121-116600143 CTGGCAATGGCAAGTGAGTCTGG - Intergenic
983527103 4:168770536-168770558 CTGGGAAAAGGAAGTGTCTGTGG + Intronic
985492972 5:190005-190027 CTGGAAAGGGGCCGTGTGTCTGG + Intergenic
985503928 5:267316-267338 CTGGAAAAAGGAAAAGTGACTGG + Intergenic
986081975 5:4404421-4404443 CTGGAAACTTGAAGTGTGTGGGG + Intergenic
986617105 5:9629059-9629081 CTGGCTGAGGGAAGTGTGGCAGG + Exonic
987436277 5:17897490-17897512 CAGGAAAAGGCCAGTGTGGCTGG + Intergenic
989220693 5:38958917-38958939 CTTGAAAAGGGAAGAATGCCTGG + Intronic
989281456 5:39648956-39648978 TTGGAGAAGGGCAGTGGGTCAGG - Intergenic
989420444 5:41233498-41233520 ATGGCAAAGGGAAGACTGTCAGG + Intronic
990915462 5:60898623-60898645 CTGGAAAAGAAAAGTATGTTAGG - Intronic
992127398 5:73655866-73655888 CTGTAAAAGGGAAGAGTTTGGGG + Intronic
992967682 5:82019973-82019995 CTGGATTAGGGAAGTGTGCCAGG + Intronic
992977104 5:82131871-82131893 CTGGGATAGGGGAGGGTGTCAGG + Intronic
993543132 5:89177085-89177107 CTGGAAGAGGAAATTGTGTAGGG + Intergenic
993772719 5:91950481-91950503 CTGAAAAAGGCCAGTGTGGCTGG + Intergenic
998215665 5:140237084-140237106 GTGGAAAGTGGAAGTGTGGCGGG + Intronic
998620833 5:143792609-143792631 CTGAAAAAGGGCAGTGAGCCAGG - Intergenic
998680839 5:144465449-144465471 CTGGAGAAAGAAAGGGTGTCAGG - Intronic
1000759664 5:165206673-165206695 CTGGGAAAGAGAAGTGTGTGGGG + Intergenic
1000772592 5:165375019-165375041 CTTGATAAGGGAATTGTGTCTGG + Intergenic
1001023401 5:168203352-168203374 CTCTAAAGGGGAATTGTGTCAGG + Intronic
1001123097 5:168996121-168996143 CTGGGACAGGGAAGGGTGTGGGG + Intronic
1001871727 5:175161977-175161999 CTGGAAAATGTAAAGGTGTCAGG + Intergenic
1002472447 5:179444201-179444223 CTAGAAAAGGGAGCTGTGGCCGG + Intergenic
1002762048 6:209770-209792 CAGGAAAAGGGAAGAGAGCCGGG + Intergenic
1003044874 6:2724482-2724504 CTGGAGAAAGGAAGTGTGAAGGG + Intronic
1003354385 6:5353056-5353078 CTGTAGAAGGGAAGTGTGATTGG - Intronic
1004423604 6:15492764-15492786 CTGAAAAAGGCAAGTGTCACTGG - Intronic
1005870510 6:29971508-29971530 CTGGAAAAAGACAGTGGGTCAGG - Intergenic
1006701016 6:35973352-35973374 GTGGAAAAGGCCAATGTGTCCGG + Intronic
1006830719 6:36966637-36966659 CTGGCAAAGGGAGGGGTGACAGG - Intergenic
1007102778 6:39261528-39261550 GTGGCAAAGGGATGTGTGTTCGG + Intergenic
1007181807 6:39934225-39934247 GGGGAAAAGGGCAGTGTGCCGGG + Intronic
1007926944 6:45657362-45657384 CTGGAGAAAGCCAGTGTGTCTGG - Intronic
1007953333 6:45893010-45893032 CTAGAAAAGGGAACTGTATAAGG - Intergenic
1011018743 6:82787511-82787533 GTGGGAAAGTGAAGTGGGTCAGG - Intergenic
1011299083 6:85854973-85854995 CTGGAAGGGAGGAGTGTGTCTGG + Intergenic
1014643182 6:123939795-123939817 CTGGAAAAAAAAAGTGTGGCTGG - Intronic
1018170219 6:161138557-161138579 CAGAAAATGGAAAGTGTGTCAGG - Intronic
1021524648 7:21573809-21573831 ATATAACAGGGAAGTGTGTCAGG + Intronic
1023980670 7:45068271-45068293 TTAGAGAAGCGAAGTGTGTCTGG + Intronic
1024593865 7:50915946-50915968 CAGGAAAAGGGAACTGGGGCTGG - Intergenic
1025899674 7:65733619-65733641 CTGGAAGAGGGAGAGGTGTCTGG - Intergenic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026501289 7:70945264-70945286 CTCCAAAATGGAAGTGTGTGAGG - Intergenic
1026739737 7:72971397-72971419 CAGGAAGAGGGAACTGTGTGAGG + Intergenic
1026790769 7:73330022-73330044 CAGGAAGAGGGAACTGTGTGAGG + Intronic
1027103995 7:75393673-75393695 CAGGAAGAGGGAACTGTGTGAGG - Intergenic
1029156144 7:98519402-98519424 CTGGAAAATGGAATAATGTCAGG - Intergenic
1031421807 7:121562048-121562070 GTGGAGAAGGGAAGTGGGACAGG - Intergenic
1032986714 7:137345515-137345537 CAGGAAAAGGGAATAATGTCTGG + Intergenic
1035148322 7:156843131-156843153 CAGGAAAAGGGAAGCTTGTGAGG - Intronic
1036279484 8:7387791-7387813 CAGGAAAAAAGAAATGTGTCTGG + Intergenic
1036753338 8:11456786-11456808 CTGGCTAAGGGAAGTGAGTGGGG + Intronic
1037353374 8:17990064-17990086 CTAGAAAGGCGAAGTGTGTGTGG + Intronic
1037764708 8:21765404-21765426 CAAGAAAGGGGAAGTGGGTCAGG - Intronic
1039399474 8:37257021-37257043 ATGGAGAAAGGAGGTGTGTCAGG + Intergenic
1039620760 8:38995605-38995627 TTGGAGAAGGGAGGTGTTTCTGG + Intronic
1040868331 8:52073509-52073531 CTGGGAAAAGAAAGTGTGTTTGG - Intergenic
1041565691 8:59275619-59275641 ATGGGAAAGGGAAGTCTGTGAGG + Intergenic
1042063380 8:64846053-64846075 CAGGAAATTCGAAGTGTGTCTGG + Intergenic
1042424335 8:68629454-68629476 CTGGAAAAGGGAGATGTGGCAGG - Intronic
1043780671 8:84330715-84330737 CTGGACAAAGGAAGTGAGTCGGG - Intronic
1045432759 8:102128611-102128633 AGAGAAAAGGGAAGTGAGTCAGG + Intergenic
1047513742 8:125535631-125535653 ATGGAAAAGGGTAGTATGACTGG + Intergenic
1048234330 8:132675279-132675301 CTGGAAAAGGCCAGGCTGTCCGG + Intronic
1048375979 8:133822623-133822645 CTGGAAAAGGGACTCGGGTCTGG + Intergenic
1051764422 9:20506818-20506840 ATGGGAAAGAGAAGTGTATCTGG + Intronic
1052460179 9:28752933-28752955 TTGAAAAAGGTAACTGTGTCTGG + Intergenic
1053064456 9:35057711-35057733 CTGGAAAAGGGAAAACTGTAGGG + Intronic
1053472807 9:38358964-38358986 CTGCAAAATGCAAGTGAGTCAGG - Intergenic
1056505565 9:87255060-87255082 ATGGTGAAGGGAAGTGTCTCCGG - Intergenic
1056940798 9:90954379-90954401 CTGGAAATGGCAACTGTGGCAGG + Intergenic
1057798319 9:98173747-98173769 TTAGAGAAGGGAAGTGAGTCTGG - Intronic
1059139258 9:111836393-111836415 CTGGAATGGGGAAGTGTCCCTGG + Intergenic
1059718599 9:116936630-116936652 CTGGAAGAGAGAAATGTCTCTGG - Intronic
1059805811 9:117799056-117799078 CTGGGCAAGGGAAGTATGTTGGG + Intergenic
1061527479 9:131178803-131178825 CTGGAGAAGGGAAGTGAGGGAGG - Intronic
1185925439 X:4140577-4140599 ATGGCAAGGAGAAGTGTGTCAGG + Intergenic
1186174478 X:6910655-6910677 CTAAAAAAAGGAAGTGTTTCTGG + Intergenic
1186458791 X:9731835-9731857 GTGGAAAAGAGAACTGTGCCAGG + Intronic
1187774897 X:22745421-22745443 CTGGAAAGGTCAAGTGTTTCAGG + Intergenic
1188508860 X:30912220-30912242 CAGGAAATGGGCAATGTGTCAGG - Intronic
1190641953 X:52488444-52488466 CTGGCCATGGGAAGTGAGTCTGG - Intergenic
1190645719 X:52524422-52524444 CTGGCCATGGGAAGTGAGTCTGG + Intergenic
1191182727 X:57580090-57580112 CTGGAAAAGGGAAGCTTTACAGG + Intergenic
1193870543 X:86792525-86792547 CTGGGAAAGGTATGTGTGTTGGG - Intronic
1194436011 X:93869025-93869047 CTGGAAAGGGGAGTTGTGTAGGG + Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196278928 X:113799951-113799973 CTGGAAAAGGCAAATGTATTAGG - Intergenic
1198384096 X:136111805-136111827 CTGGACAAGGATAGTGTGGCTGG - Intergenic
1198946108 X:142016176-142016198 CTGGAAAAGGCAAGACTGTAGGG + Intergenic
1199408503 X:147491712-147491734 CAGGAAAAGAGAAGTGTTTATGG + Intergenic
1199737278 X:150695835-150695857 CTGGAAAAGGGAATTGGGCTAGG + Intronic
1200259053 X:154602331-154602353 CTGGCAGAGGGAAGGGTGACCGG - Intergenic
1201719032 Y:17077257-17077279 GGAGAAAAAGGAAGTGTGTCAGG - Intergenic
1201719614 Y:17082241-17082263 CAGGAAACATGAAGTGTGTCAGG - Intergenic