ID: 917076488

View in Genome Browser
Species Human (GRCh38)
Location 1:171211433-171211455
Sequence CACTACCCATTTAGTAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917076485_917076488 12 Left 917076485 1:171211398-171211420 CCCATTTTGCATAACTTGCCTTA 0: 1
1: 0
2: 0
3: 9
4: 163
Right 917076488 1:171211433-171211455 CACTACCCATTTAGTAGCTATGG 0: 1
1: 0
2: 0
3: 15
4: 57
917076486_917076488 11 Left 917076486 1:171211399-171211421 CCATTTTGCATAACTTGCCTTAT 0: 1
1: 0
2: 0
3: 19
4: 255
Right 917076488 1:171211433-171211455 CACTACCCATTTAGTAGCTATGG 0: 1
1: 0
2: 0
3: 15
4: 57
917076487_917076488 -6 Left 917076487 1:171211416-171211438 CCTTATTTCATCATTATCACTAC 0: 1
1: 0
2: 1
3: 30
4: 239
Right 917076488 1:171211433-171211455 CACTACCCATTTAGTAGCTATGG 0: 1
1: 0
2: 0
3: 15
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917076488 Original CRISPR CACTACCCATTTAGTAGCTA TGG Intergenic
904108479 1:28106271-28106293 AACTCCCCATTTTGTAGCTGAGG - Intergenic
906613830 1:47221729-47221751 CACTGCCCATTTTATAGCTAAGG + Intronic
908349734 1:63273052-63273074 AACTACCAATTTAGAAGTTATGG - Intergenic
910326819 1:86018770-86018792 CCCTATCCATTTTTTAGCTAGGG - Intronic
910406597 1:86897682-86897704 CACTAACCACTTATTAGCTAGGG - Intronic
910650878 1:89565665-89565687 CACCACCCATTTAGGAACCAAGG - Intronic
911544914 1:99204739-99204761 CAGTAACTATTTAGGAGCTATGG + Intergenic
917076488 1:171211433-171211455 CACTACCCATTTAGTAGCTATGG + Intergenic
918519696 1:185402659-185402681 CTCTACCCATTTAATGGCTGTGG + Intergenic
1067792062 10:49295839-49295861 CACTATCCATTGGGGAGCTAGGG - Intergenic
1079720905 11:23812818-23812840 CATTTCCCATTTAGCATCTAGGG + Intergenic
1086179455 11:83933170-83933192 CACTTCCCATTTAGTTGGTAAGG + Intronic
1093451033 12:19314177-19314199 GACTACCTTTTTAGAAGCTAAGG + Intronic
1096059338 12:48683148-48683170 CCTTTCCCATTTAATAGCTATGG - Intergenic
1097993782 12:65865078-65865100 CACTACTCATTAAGTAGAAATGG - Intronic
1098846559 12:75544220-75544242 CACTCCCTACTTCGTAGCTAAGG - Intergenic
1103333529 12:120171541-120171563 ATGTACCCATTTAGTAGCTATGG - Intronic
1109561106 13:64051792-64051814 CACTACACATTTATTAGAAAAGG - Intergenic
1111756782 13:92406972-92406994 TACTACCCATTTTCTAGTTAAGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1124451274 15:29793658-29793680 CACTAACTATATAGTAGCAAGGG + Intronic
1127219579 15:56864273-56864295 CATTATCCTTTTAGTATCTATGG - Intronic
1127958182 15:63871173-63871195 CACTACCCTGTGATTAGCTATGG + Intergenic
1128855641 15:71011717-71011739 CACTACTTAGTTATTAGCTAAGG + Intronic
1130310876 15:82753070-82753092 GACTACCAATTTAGTAGATTTGG + Intergenic
1130936489 15:88475321-88475343 TACTACCCATTCAGAAGCAAGGG + Intronic
1140401872 16:74678355-74678377 CACTGCCCATTTAGCAGGGATGG - Intronic
1144528094 17:16008363-16008385 CACTACTCATTTAGTTGCTTTGG + Intronic
1154510561 18:15096679-15096701 CACTAACCATTCATTAGCTATGG - Intergenic
1156735515 18:40253756-40253778 CAGCACCCCTTTGGTAGCTAAGG + Intergenic
1162806158 19:13138939-13138961 GACTACCCATTTTATAGCTGGGG + Exonic
1164757834 19:30703412-30703434 AACTCCCCATTTAGAAGGTAGGG - Intronic
926214671 2:10897276-10897298 CACCAAGCATGTAGTAGCTATGG - Intergenic
926621903 2:15054211-15054233 TACTACCCATTTCATAGGTAAGG + Intergenic
933305835 2:80597216-80597238 CAGTACCCATTTATTAAATAGGG - Intronic
938505779 2:131881126-131881148 CACTAACCATTCATTAGCTATGG - Intergenic
939916971 2:148058338-148058360 CTCTTCCCACTTACTAGCTAAGG - Intronic
944371433 2:198987923-198987945 CACTACACACTTAGTGGCTTAGG - Intergenic
945766769 2:213990426-213990448 CAGTAGGCATTTAGTAGCTAAGG - Intronic
945982792 2:216327628-216327650 TATTACCCATTTAAAAGCTAGGG - Intronic
946898817 2:224353142-224353164 CACTACACAGTTAGCATCTATGG - Intergenic
1169889024 20:10433433-10433455 CACTGCCGAGTTAGTAGATACGG - Intronic
1170068050 20:12335973-12335995 CACTACTCATATTGTAACTAGGG + Intergenic
1170730403 20:18970008-18970030 CACTACACATTTAGCAGTTTAGG + Intergenic
1176787307 21:13272731-13272753 CACTAACCATTCATTAGCTATGG + Intergenic
1177986466 21:27981225-27981247 CACTAAGCATTCATTAGCTATGG + Intergenic
949499688 3:4667791-4667813 AACTACCCATTTAGCAGATAAGG - Intronic
957467508 3:80613470-80613492 CACTACCTAGTCAGTAGCTGGGG + Intergenic
958711548 3:97722895-97722917 CACCACCCATTTAGTAACCATGG + Intronic
964020169 3:152000387-152000409 TACTCCCCATTTTGTAGATAAGG + Intergenic
965970628 3:174551322-174551344 CACTAACCATAGAGTAGCTTGGG - Intronic
967104841 3:186247273-186247295 CAGAACCCATTTAATAGCTGAGG - Intronic
968780886 4:2580505-2580527 CACCCCCCATTTTGGAGCTAGGG + Intronic
975902330 4:79167474-79167496 GACTCCCCATTTAATAGGTATGG - Intergenic
976044448 4:80929183-80929205 CACTACCCATCCAGTATCTATGG + Intronic
976044463 4:80929285-80929307 CACTACCCATCCAGTCTCTATGG + Intronic
977276286 4:94981112-94981134 CACTACCAATTTTTTATCTAAGG - Intronic
979910314 4:126357045-126357067 CATTACCAATTTAGCAGCCACGG + Intergenic
986580005 5:9255931-9255953 CACTACCCACTTAGTTGCTCTGG + Intronic
987001119 5:13661252-13661274 CACCACCTATTTATTATCTAAGG + Intergenic
989529329 5:42488796-42488818 CACTACCCATATGTTAGCTGTGG - Intronic
989734377 5:44686116-44686138 CACTACCATTTTAGTAGTTCTGG - Intergenic
999139190 5:149346148-149346170 TATTACCCATTTAGTAGTTAAGG + Intronic
1003426435 6:6001105-6001127 CACTAGCCATTTAGCTGCTATGG + Intronic
1005888857 6:30119828-30119850 CGCTACCCAGTTATTTGCTATGG + Intergenic
1007288239 6:40763591-40763613 CAATACCCATTTTCTAGCCAAGG - Intergenic
1015107155 6:129550510-129550532 CATTACCCTTTTAGTAACTGGGG - Intergenic
1024537076 7:50445860-50445882 ACCTACCCATTTAGAAGTTAAGG + Exonic
1029254506 7:99260471-99260493 CAGTACCCATTTTGCAGATAGGG - Intergenic
1036180879 8:6584210-6584232 CACTACAGATTTAGCAGCTCAGG + Intronic
1038391666 8:27207558-27207580 CTCTACCCATTTATCAGCTGTGG - Intergenic
1186220217 X:7342156-7342178 CACTACACATTTAGGAGATGTGG + Intronic
1187189748 X:17022862-17022884 CATTACCCATTTAGCAGGTTTGG + Intronic