ID: 917078594

View in Genome Browser
Species Human (GRCh38)
Location 1:171233324-171233346
Sequence CAGTATTTACAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917078585_917078594 25 Left 917078585 1:171233276-171233298 CCTGAACCACTAAAGGTCCAGAA No data
Right 917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG No data
917078592_917078594 -6 Left 917078592 1:171233307-171233329 CCAACAAGATGGGCAGGCAGTAT No data
Right 917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG No data
917078586_917078594 19 Left 917078586 1:171233282-171233304 CCACTAAAGGTCCAGAATGCTTC No data
Right 917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG No data
917078591_917078594 -5 Left 917078591 1:171233306-171233328 CCCAACAAGATGGGCAGGCAGTA No data
Right 917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG No data
917078587_917078594 8 Left 917078587 1:171233293-171233315 CCAGAATGCTTCACCCAACAAGA No data
Right 917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917078594 Original CRISPR CAGTATTTACAGATGGAAAA AGG Intergenic
No off target data available for this crispr