ID: 917078680

View in Genome Browser
Species Human (GRCh38)
Location 1:171234427-171234449
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917078680_917078685 -9 Left 917078680 1:171234427-171234449 CCCTTCACCCTCTGCATGGATTA No data
Right 917078685 1:171234441-171234463 CATGGATTATAGGTTTCCTGAGG No data
917078680_917078687 8 Left 917078680 1:171234427-171234449 CCCTTCACCCTCTGCATGGATTA No data
Right 917078687 1:171234458-171234480 CTGAGGCTTCCCCAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917078680 Original CRISPR TAATCCATGCAGAGGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr