ID: 917078768

View in Genome Browser
Species Human (GRCh38)
Location 1:171235311-171235333
Sequence CTGAATATACAAAGGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917078768_917078771 9 Left 917078768 1:171235311-171235333 CCTGTGGCCCTTTGTATATTCAG No data
Right 917078771 1:171235343-171235365 TAAACACAAAAAATATGTAGTGG No data
917078768_917078772 12 Left 917078768 1:171235311-171235333 CCTGTGGCCCTTTGTATATTCAG No data
Right 917078772 1:171235346-171235368 ACACAAAAAATATGTAGTGGAGG No data
917078768_917078774 26 Left 917078768 1:171235311-171235333 CCTGTGGCCCTTTGTATATTCAG No data
Right 917078774 1:171235360-171235382 TAGTGGAGGTGGATTTTTTGTGG No data
917078768_917078773 15 Left 917078768 1:171235311-171235333 CCTGTGGCCCTTTGTATATTCAG No data
Right 917078773 1:171235349-171235371 CAAAAAATATGTAGTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917078768 Original CRISPR CTGAATATACAAAGGGCCAC AGG (reversed) Intergenic
No off target data available for this crispr