ID: 917083810

View in Genome Browser
Species Human (GRCh38)
Location 1:171285304-171285326
Sequence GAGCCAGATGTGGATCCGTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917083810_917083812 -7 Left 917083810 1:171285304-171285326 CCTAACGGATCCACATCTGGCTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 917083812 1:171285320-171285342 CTGGCTCTGACCGTCTTCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 189
917083810_917083817 26 Left 917083810 1:171285304-171285326 CCTAACGGATCCACATCTGGCTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 917083817 1:171285353-171285375 CCATACCAGTTCCGCTTGACTGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917083810 Original CRISPR GAGCCAGATGTGGATCCGTT AGG (reversed) Exonic
904486083 1:30825201-30825223 GAGCCAGATGAGGAACGGTGGGG + Intergenic
905143684 1:35869762-35869784 GAGCCAAATGTGGACCTGTGAGG + Intergenic
913179839 1:116310998-116311020 GAGGCAGAAGTGGGTCCATTTGG + Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917162195 1:172070275-172070297 GAGCCAGATATGGAGCCCTAGGG + Intronic
924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG + Intergenic
924701379 1:246456929-246456951 GAGCCAGATTTGGATTAGTCTGG - Intronic
1064352425 10:14588550-14588572 GAGCCAGATGTGGGTGCCTCCGG - Intronic
1067277283 10:44846825-44846847 GATCCAGAGGCAGATCCGTTGGG - Intergenic
1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG + Intronic
1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG + Intergenic
1076651606 10:131993121-131993143 CAGCCAGATGAGGAACCTTTTGG - Intergenic
1084358118 11:68652743-68652765 GCCCCAGATGTAGATCCATTAGG - Intergenic
1085151600 11:74256800-74256822 GAGGCAGATGTAGATCTGATGGG + Intronic
1086038448 11:82445135-82445157 GAGCCAGAGGAGGAGCTGTTAGG - Intergenic
1086210331 11:84310579-84310601 GTGGCAGATGTGAAGCCGTTTGG - Intronic
1087023087 11:93622609-93622631 CAGCCAGATGTGGTGCTGTTTGG - Intergenic
1097378400 12:58865249-58865271 GAGCCAGCTGTGTATTCCTTAGG - Intergenic
1097446399 12:59678031-59678053 GAGCCAGGTGTGGAGCAGTGAGG + Intronic
1098290719 12:68955054-68955076 GAGCCAGATGTGGAGCAGCAAGG - Intronic
1104112023 12:125713093-125713115 GACTCAGCTGTGGATCCTTTGGG + Intergenic
1113440504 13:110324568-110324590 GAGTCAAACGTGCATCCGTTCGG - Intronic
1131061159 15:89405547-89405569 GAGTCAGATTTGGGTGCGTTTGG + Intergenic
1131268384 15:90932181-90932203 GAGCCAGATGTGGCCCCTTGTGG + Intronic
1137334190 16:47532495-47532517 GAGCCAGATGTGGAGTGGTGAGG + Intronic
1141083749 16:81076946-81076968 GGGCCTGAGGAGGATCCGTTGGG - Intronic
1142491527 17:283004-283026 GAGGCAGAGGTGGATGTGTTGGG + Intronic
1148114885 17:45169755-45169777 GAACCAGATGTGGAACCGAGAGG + Exonic
1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG + Intronic
1155374062 18:25136994-25137016 GAGACAGAGGAGGATCCTTTTGG - Intronic
927655903 2:24946306-24946328 GAGGCAAGTGTGGATCCTTTGGG - Exonic
929571667 2:43026784-43026806 GGGCTAGATGTGGAGCCGGTTGG - Intergenic
933058978 2:77711480-77711502 GAGCAAGATGCAGAACCGTTAGG - Intergenic
937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG + Intronic
939883588 2:147657247-147657269 GAGCCAGATGTGGCTGCTCTTGG - Intergenic
942451796 2:176112734-176112756 CAGCCAGATGTGCAGCCGCTGGG - Intronic
948244098 2:236463790-236463812 GAACCAGATGTGGCTCAGCTGGG + Intronic
948656889 2:239481850-239481872 GAGCCAGCTGTGGATCCTCAGGG - Intergenic
1168957150 20:1842087-1842109 GAGCCAGATGTGGAATTGCTGGG - Intergenic
1172653994 20:36525824-36525846 GGGCCAGATGGGGATCAGTGGGG - Intronic
1173935379 20:46857588-46857610 GAGCCAGATGTGGAAAGGTGAGG + Intergenic
1173941541 20:46915094-46915116 GAGGCTGATGTGGCTCCTTTGGG - Intronic
1179497286 21:41780689-41780711 GAACCAAATGTGTATCCATTTGG + Intergenic
1182427467 22:30282548-30282570 AAGCCAGCTGTGGAACCATTTGG + Intergenic
1185323695 22:50215468-50215490 GTGCCAGGTGTGGGTCCGTGTGG + Intronic
950207738 3:11093403-11093425 GAGCCAGGTGTGGAACGGTGAGG - Intergenic
952570356 3:34708675-34708697 GAGTCAAATGTGGATCAGTGGGG - Intergenic
954320568 3:49829705-49829727 GAGCCAGATGAGGAACTGGTTGG - Exonic
954601844 3:51876367-51876389 GAGGCCGATGTGGATCTGTAGGG + Intergenic
956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG + Intergenic
958977541 3:100683595-100683617 GAGCCAGGTGTGGAGCGGTGAGG - Intronic
959140516 3:102480936-102480958 TAGCCAGAAGAGGATTCGTTTGG + Intergenic
963384972 3:144581195-144581217 GTGCCAGAGGAGGAGCCGTTGGG + Intergenic
963908111 3:150790990-150791012 GAGCCAGATGTGCTTCAGTGAGG + Intergenic
975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG + Intergenic
975973364 4:80069059-80069081 GAGAAAGATATGGATCCTTTTGG - Intronic
979698311 4:123639241-123639263 GAGACAGATGTGGGTCATTTTGG + Intergenic
988506160 5:31825214-31825236 AATCCAGATGTGGTTCCGTTTGG - Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1008888995 6:56463620-56463642 GACACAGAAGTGGATCTGTTGGG + Exonic
1015983567 6:138863514-138863536 GAGCCAAATGTGCTACCGTTTGG - Intronic
1017094886 6:150796059-150796081 CACCCAGATATGGATCCGTCTGG + Intronic
1018185461 6:161262435-161262457 GAGCCAGCTGTGGAAGAGTTTGG - Intronic
1023764544 7:43498366-43498388 TAACCAGATGTTGATCCCTTGGG + Intronic
1024915629 7:54495908-54495930 AAGTCAGATGTGGATATGTTTGG + Intergenic
1026342714 7:69447933-69447955 GAGCCAGAGGTGGGTGCTTTAGG - Intergenic
1028654751 7:93191954-93191976 TACCCAGATGTGGATTCCTTGGG + Intronic
1034805900 7:154088920-154088942 GAGCCACATGTGGCTCCGGCTGG + Intronic
1046009166 8:108525515-108525537 GAGCCACATGTGGATCAGGAAGG - Intergenic
1048823018 8:138397029-138397051 GAGCCAGGTGTGCATCCCTCAGG + Intronic
1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG + Intronic
1188916634 X:35919756-35919778 AAAACAGATGTGGATCCGTCCGG - Exonic