ID: 917083812

View in Genome Browser
Species Human (GRCh38)
Location 1:171285320-171285342
Sequence CTGGCTCTGACCGTCTTCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917083804_917083812 30 Left 917083804 1:171285267-171285289 CCTATATCAATGCAAAACCCAAC 0: 1
1: 0
2: 2
3: 13
4: 180
Right 917083812 1:171285320-171285342 CTGGCTCTGACCGTCTTCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 189
917083810_917083812 -7 Left 917083810 1:171285304-171285326 CCTAACGGATCCACATCTGGCTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 917083812 1:171285320-171285342 CTGGCTCTGACCGTCTTCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 189
917083807_917083812 8 Left 917083807 1:171285289-171285311 CCTGTTCTCTATGCTCCTAACGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 917083812 1:171285320-171285342 CTGGCTCTGACCGTCTTCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 189
917083806_917083812 12 Left 917083806 1:171285285-171285307 CCAACCTGTTCTCTATGCTCCTA 0: 1
1: 0
2: 3
3: 24
4: 225
Right 917083812 1:171285320-171285342 CTGGCTCTGACCGTCTTCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 189
917083805_917083812 13 Left 917083805 1:171285284-171285306 CCCAACCTGTTCTCTATGCTCCT 0: 1
1: 0
2: 2
3: 14
4: 276
Right 917083812 1:171285320-171285342 CTGGCTCTGACCGTCTTCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917083812 Original CRISPR CTGGCTCTGACCGTCTTCTT TGG Exonic
900883957 1:5402369-5402391 CTGGCTCTGAGGGACTGCTTAGG + Intergenic
901641879 1:10696776-10696798 CTGGCTCTGAATGTCTTCCTGGG + Intronic
901673446 1:10869040-10869062 CTCTCTCTTACCGTTTTCTTTGG - Intergenic
901840788 1:11952724-11952746 CTGCCTCTTACCCTCTTCTCCGG - Exonic
903627584 1:24742646-24742668 CTGGGTCTGAGCCTCTTCCTGGG + Intergenic
905856366 1:41317281-41317303 CTGGCTCTGAGTCTCTTCCTTGG - Intergenic
906149341 1:43578422-43578444 CTGGCTCTGACTGGCTTAGTGGG + Intronic
909789638 1:79659694-79659716 CTGGCTCTGGGTGTCTCCTTTGG - Intergenic
910480255 1:87650893-87650915 CTTGCTCTCACTGGCTTCTTGGG + Intergenic
911386979 1:97188643-97188665 CTGTCTATGACCCTCTTCCTTGG - Intronic
915059810 1:153171981-153172003 CTTGTTCAGACCTTCTTCTTTGG + Intergenic
915076391 1:153311423-153311445 CTGGCTCTGACCCTATTATCTGG - Intergenic
915986366 1:160469417-160469439 CTGGCTCTGGGTTTCTTCTTTGG + Intergenic
916553134 1:165869045-165869067 CTGTCTCTCTCCCTCTTCTTGGG - Intronic
916599769 1:166281454-166281476 CTGCCTCTGAACTTCTTTTTAGG - Intergenic
917083812 1:171285320-171285342 CTGGCTCTGACCGTCTTCTTTGG + Exonic
917520412 1:175743527-175743549 CTGGGTCTGCCCGTCTCCTCTGG + Exonic
917809304 1:178642066-178642088 CTGGCTCTGTGTCTCTTCTTTGG + Intergenic
919545876 1:198917861-198917883 CTGTCTCTCTCCCTCTTCTTGGG + Intergenic
921015153 1:211183000-211183022 CTGGCTCTGCTTCTCTTCTTCGG - Intergenic
921273377 1:213492083-213492105 CTGGCTCAGAGCCTCTTCTTTGG + Intergenic
921899719 1:220437182-220437204 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
922239026 1:223743393-223743415 CTGGCTCTGACCTTCCTCCTAGG + Intronic
923561829 1:235047487-235047509 CTGGTTCTGACCCTCTTGTGTGG - Intergenic
924487627 1:244501851-244501873 CTGCCTCTGCCCCTCTTCTCTGG + Intronic
1062919032 10:1265830-1265852 CTGGCTCAGGCCGTCTTCCGGGG - Intronic
1062919058 10:1265898-1265920 CTGGCTCAGGCCGTCTTCCGGGG - Intronic
1062919105 10:1266034-1266056 CTGGCTCAGGCCGTCTTCCGGGG - Intronic
1063059575 10:2537509-2537531 CTGCCTCTGATTGTCATCTTTGG + Intergenic
1065950454 10:30646524-30646546 CTGGCTCTGGGTCTCTTCTTCGG - Intergenic
1067176725 10:43955229-43955251 CTTGCTGTGACCGTCTCCTGTGG + Intergenic
1067787370 10:49260329-49260351 CTGGCTCCAACCATCTTCTTTGG + Intergenic
1068423704 10:56828324-56828346 CTGGCTCTGATCTTTTGCTTAGG - Intergenic
1070333646 10:75435797-75435819 CAGGCTCTAACACTCTTCTTGGG + Intronic
1071488003 10:86115699-86115721 CTGGCTCTGTCGGTCCTTTTAGG - Intronic
1073095586 10:100977797-100977819 CTGGCTCTGAGTCTCTTCTTTGG - Intronic
1075649141 10:124116207-124116229 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1077211163 11:1371582-1371604 CTGGCTCTGGCCGTCCTCCCGGG + Intergenic
1077824715 11:5793767-5793789 CTGTCTCTCTCCCTCTTCTTGGG + Intronic
1078107310 11:8366400-8366422 CCGGCTCTAACCGTCTCCTGTGG - Intergenic
1078370886 11:10744008-10744030 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1079359110 11:19755805-19755827 CTGGCTCTGGGTCTCTTCTTTGG - Intronic
1088625124 11:111724417-111724439 CTGGGTCTGAATGTCTTCTTAGG - Exonic
1088901961 11:114125011-114125033 CTGGGCCTGACCCTCTTCTCGGG + Intronic
1091180351 11:133599019-133599041 CTGCCTCTGAGCTTGTTCTTTGG - Intergenic
1091285658 11:134407323-134407345 CTGGCTCTGCCCGTCCTCTCTGG - Intronic
1096028315 12:48387462-48387484 CTGGCTCTGAGTCTCTTCTTTGG + Intergenic
1096993963 12:55827640-55827662 CTGGCTCTGGCCCTCTTTTTGGG - Exonic
1098573860 12:72018597-72018619 CTGGCTCTGAACGTGTATTTTGG + Intronic
1101267132 12:103100763-103100785 CTGGCTCTGCCCTATTTCTTGGG + Intergenic
1102547864 12:113669808-113669830 CTGGCTCTTTCCGTGTGCTTAGG - Intergenic
1103841733 12:123870680-123870702 CTGGCTCTGAGCATCTTCCGTGG + Intronic
1105430572 13:20333774-20333796 CTGGCTCTGGGTCTCTTCTTGGG - Intergenic
1107006574 13:35619312-35619334 CTGGCTCTGGGTCTCTTCTTTGG - Intronic
1108010347 13:46000936-46000958 CTGTCTCTCACCATCTCCTTGGG - Intronic
1108535282 13:51370518-51370540 CTGGCTCTGGGTCTCTTCTTTGG - Intronic
1108690777 13:52857455-52857477 CTGGCTCTGAGCTCCTGCTTTGG + Intergenic
1115170567 14:30500966-30500988 CTGGCTCTTGCCTTCTTCTTTGG + Intergenic
1116273268 14:42799639-42799661 CTGGTTCTGAGTCTCTTCTTTGG - Intergenic
1118534991 14:66752486-66752508 CTGTCTCTCTCCCTCTTCTTGGG - Intronic
1121431864 14:93893414-93893436 TTGGCTCTGAAAGTCTTCTATGG + Intergenic
1124002575 15:25771137-25771159 CTGGCTCTGGGTCTCTTCTTCGG + Intronic
1125896460 15:43306933-43306955 CTGGCTATGAATGTCTCCTTGGG - Intergenic
1127147832 15:56043033-56043055 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1128066197 15:64766142-64766164 CAGGCTCTGTCCGTCCTCCTTGG + Intronic
1128629350 15:69247766-69247788 CTGTTTCTGACCTTCTCCTTGGG - Intronic
1129224083 15:74156116-74156138 CTGTTTCTTACCGTCTGCTTTGG + Intergenic
1132213707 15:100047083-100047105 CTGGGTGTGGCCGTCTTCTATGG + Intronic
1132466417 16:79323-79345 CTGGATCTGACCACCTGCTTTGG - Exonic
1135066436 16:19314216-19314238 CTGGCTCTGGGTCTCTTCTTTGG - Intronic
1135956811 16:26962791-26962813 CTGGCTCTGGGTTTCTTCTTTGG + Intergenic
1142027604 16:87822934-87822956 CTGGCTGTGACCTACCTCTTTGG - Intergenic
1142670136 17:1484318-1484340 ATGACTCTGACCCTCTTCTGTGG - Intronic
1144272451 17:13631018-13631040 CTGGCTCTGGGTTTCTTCTTTGG + Intergenic
1148619453 17:49023286-49023308 CTGTCTTTGGCTGTCTTCTTTGG - Intronic
1148967168 17:51446009-51446031 CTGGCTCTGAGTGTCTTCTTTGG - Intergenic
1151426693 17:74035300-74035322 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1153346438 18:4031044-4031066 CTGGCTCTGGGTCTCTTCTTTGG + Intronic
1154018563 18:10642852-10642874 GTGGCACTGCCCTTCTTCTTAGG - Intergenic
1154185665 18:12180570-12180592 GTGGCACTGCCCTTCTTCTTAGG + Intergenic
1155213936 18:23625851-23625873 CTGCCTCTTACAGTCTTCCTGGG + Intronic
1155261718 18:24049987-24050009 CAGGGTCTGACCGTTTTCCTTGG + Intronic
1155991158 18:32280829-32280851 CTGGCTCTGCCCATCTGCTGTGG + Intronic
1156996850 18:43479134-43479156 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1157957869 18:52119059-52119081 CTGACTCAGACCCTCTACTTAGG - Intergenic
1158877337 18:61745782-61745804 CTGGCTCTGGATCTCTTCTTCGG + Intergenic
1159362793 18:67427050-67427072 TTGGCTCTCACCAACTTCTTGGG - Intergenic
1159674747 18:71268491-71268513 CTGGCTATCACAGTCTTCTAGGG - Intergenic
1159778512 18:72632567-72632589 GTGGCCATGACTGTCTTCTTAGG + Intronic
1160709512 19:544617-544639 CTACCTCTGTCCATCTTCTTGGG - Intronic
1162610239 19:11744093-11744115 TTGGCTCTGACGATCTTCCTTGG - Intergenic
1163871983 19:19829892-19829914 CTGGTTCTGAACTTCTTTTTTGG - Intergenic
1164566661 19:29330600-29330622 GTGGCTCTGACTGCCTGCTTGGG - Intergenic
1165952757 19:39483346-39483368 CTGTCTCTGACCATCTGCTCGGG - Intronic
1166310157 19:41958339-41958361 GTGGCTCTGGCTGTCTTTTTCGG - Exonic
1166936638 19:46337547-46337569 CTGGCTGTCTCTGTCTTCTTTGG + Intronic
1168710465 19:58497217-58497239 CTGGCTCTTAGTCTCTTCTTCGG - Intronic
925261702 2:2535026-2535048 CTGCTCCTGACTGTCTTCTTAGG - Intergenic
931498003 2:62832754-62832776 CTGGCTCTGTTCCTCTCCTTGGG + Intronic
931864996 2:66399772-66399794 TTGGCTCTGCACGTCTTCTTTGG + Intergenic
931874748 2:66499569-66499591 CTGGCTCTCCCTGTCTTCCTGGG - Intronic
933225861 2:79748930-79748952 CTGGCTCTGGGTCTCTTCTTTGG - Intronic
934640245 2:96023546-96023568 ATGGCTCTGGCCATCCTCTTGGG - Intronic
934793406 2:97081872-97081894 ATGGCTCTGGCCATCCTCTTGGG + Intergenic
935106331 2:100047404-100047426 CTGGAACTCACCGTCTCCTTGGG - Intronic
935649960 2:105373747-105373769 CTGCCTCTGACTGTCTTGTGTGG - Intronic
937894866 2:126971178-126971200 CTGCCTCTGACCCTCTCCTGGGG + Intergenic
940205257 2:151195338-151195360 CTGGCTCTGGGTCTCTTCTTTGG - Intergenic
941690306 2:168494647-168494669 CTGGCTCTGGGTCTCTTCTTCGG - Intronic
943759424 2:191592288-191592310 CTGGCTCTGGGTCTCTTCTTGGG + Intergenic
946387665 2:219394924-219394946 CTGGCTCTGGGTCTCTTCTTTGG - Intronic
946529968 2:220560316-220560338 CTGGCTCTGGGTCTCTTCTTTGG - Intergenic
948285872 2:236784727-236784749 CTGACTCTGACCGTCTTATGAGG + Intergenic
948396461 2:237648739-237648761 CAGGCTCTGACCTCCTTCCTGGG - Intronic
1171460493 20:25295454-25295476 CTGGCTCTGACCAGCTGCGTGGG + Intronic
1172660200 20:36562833-36562855 CAGGCTCTAACTGTCTTCCTTGG - Intergenic
1173310521 20:41892618-41892640 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1173709084 20:45138851-45138873 CTCTCTGTGACCGTCCTCTTTGG - Intergenic
1176982328 21:15397585-15397607 CTGCGTCTGCCCGGCTTCTTGGG - Intergenic
1181394867 22:22614080-22614102 CTGGCTCTGACCCTGATCCTGGG + Intergenic
1182388676 22:29970836-29970858 CTGACTCTGATCAGCTTCTTAGG + Intronic
1183680184 22:39323865-39323887 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1184568224 22:45306241-45306263 CTGGCTCTGGGTCTCTTCTTCGG + Intergenic
1184842513 22:47060677-47060699 CTGCCTCTGACTTTCTTTTTGGG + Intronic
1184898751 22:47430537-47430559 CTGGCACTGTCTGACTTCTTAGG - Intergenic
952328388 3:32341339-32341361 CTGGCTCCTGCCGTGTTCTTAGG - Intronic
953697908 3:45173888-45173910 CTGAGTCTGACCTTCTGCTTTGG + Intergenic
954362575 3:50129968-50129990 CTAGCTCTGAGTCTCTTCTTTGG + Intergenic
956250859 3:67232172-67232194 CTGGCTCTGGGTCTCTTCTTTGG - Intergenic
960588808 3:119345759-119345781 CTGGCTCTGTCCCTCTTCCCAGG + Intronic
962911699 3:139857619-139857641 CTGTCTTTGACAGTCTTCCTTGG + Intergenic
965072611 3:163934884-163934906 CTGGCTTTGGCCGTCCTGTTGGG - Intergenic
967136224 3:186515152-186515174 CTGGCTCTGGGTCTCTTCTTTGG - Intergenic
967307772 3:188075741-188075763 CTGGCTTTGGCTGTGTTCTTGGG - Intergenic
969457265 4:7307195-7307217 CTGGCTCTGAACGTCGCCTGGGG - Intronic
972723084 4:41720429-41720451 CTGACTCTGCCAGTCTTCCTTGG - Intergenic
972991798 4:44829640-44829662 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
973631523 4:52825028-52825050 CTGGCTCTGCCCCTCGTCTCTGG + Intergenic
973715702 4:53673913-53673935 CTGGCTCTGAGCCTCTTCTCTGG + Intronic
975610017 4:76194165-76194187 CTGGCTCTGCTCGGCTTCTGGGG - Intronic
977380099 4:96262118-96262140 CTGGCTCTGGGTCTCTTCTTTGG - Intergenic
978122176 4:105092735-105092757 CTCACTCTGACTGTGTTCTTCGG + Intergenic
981389895 4:144177034-144177056 ATGGCTTTGACTGTGTTCTTTGG + Intergenic
981822452 4:148901625-148901647 CTGGCTCTGAATCTCTTCGTCGG - Intergenic
986145373 5:5072655-5072677 CTGGCTCTAAGCTTCTTCTCTGG + Intergenic
986878735 5:12143441-12143463 CTGGCTCTTGCCTTCTTCTCAGG - Intergenic
990302056 5:54459151-54459173 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
991014552 5:61916923-61916945 CTGGCTCTGATCCTTGTCTTGGG - Intergenic
992759399 5:79938154-79938176 CTGCCTTTGATCGTTTTCTTTGG + Intergenic
993977213 5:94496962-94496984 CTGGCTCTGAGTCTCTTCTTCGG + Intronic
996597786 5:125225634-125225656 CTGGCTCTGGCCATCCACTTGGG + Intergenic
999247936 5:150165359-150165381 CTGATTCTGACCTTCTTCTGGGG + Intergenic
999956472 5:156708785-156708807 CTGGATCTGACTGTCTCTTTGGG - Intronic
1001025394 5:168220008-168220030 CTGGTTCTGACTTTCTTCTTTGG + Intronic
1001377315 5:171273523-171273545 CTGGGTCTGACCTTCTTATAAGG - Intronic
1003441397 6:6145963-6145985 CTGTCACTGACAGTCTTATTGGG + Intronic
1004926689 6:20422698-20422720 CTGTCTCTTACCCTCTTCTCGGG - Intronic
1007400334 6:41599336-41599358 CTGGCTCTGGCCGTGTTTTCTGG + Exonic
1007838630 6:44697449-44697471 CTGTCTCTGAGCCTCCTCTTGGG - Intergenic
1008727929 6:54443595-54443617 CTGGCTCTGGGCCTCTTCTTGGG - Intergenic
1012335553 6:98051707-98051729 CTGTCTCTGATCTGCTTCTTAGG + Intergenic
1013712839 6:112921522-112921544 CTGTCTCTCTCCCTCTTCTTGGG + Intergenic
1018644274 6:165932951-165932973 CTGGCTCTCTCCCTCCTCTTTGG - Intronic
1021571121 7:22066221-22066243 CTAGCACTGACTGTCTTCCTAGG - Intergenic
1021816636 7:24453576-24453598 CTGGCTCTGGGTCTCTTCTTTGG - Intergenic
1021984585 7:26086253-26086275 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1021995999 7:26178864-26178886 CTTGCCCTGACGGTTTTCTTAGG + Intronic
1022413023 7:30154063-30154085 CTGGCTCTGGGTCTCTTCTTTGG - Intronic
1022472301 7:30689267-30689289 CTGGCTCTGCCCGGCTGCCTAGG + Exonic
1023229784 7:38014419-38014441 CTGCCTCTAAATGTCTTCTTTGG + Intronic
1024785662 7:52904183-52904205 GGGACTCTGACCGTCTTCTCTGG + Intergenic
1027668348 7:81067390-81067412 CTGGCTCTGAGTCTCTTCTTTGG - Intergenic
1028250426 7:88533646-88533668 CTGGTTCTTACTGTCTTCATAGG + Intergenic
1028502649 7:91535962-91535984 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1031136592 7:117891305-117891327 CTGGCTCCGGCTCTCTTCTTTGG - Intergenic
1031953876 7:127922312-127922334 CTGGCTCAGACCATTTTCTGAGG + Intronic
1032219992 7:129987401-129987423 CTGGCTCTGGGTCTCTTCTTTGG - Intergenic
1032626459 7:133596763-133596785 CTGGCTCTGAACGTCTTGAGTGG - Intronic
1033130769 7:138743748-138743770 CTGTCTCTGCCCATCTCCTTTGG - Intronic
1036727088 8:11230053-11230075 CTGGATCTGAGCCTCTTCCTTGG - Intergenic
1037741729 8:21613931-21613953 CTGACTCTGACCTTGTTCTCTGG - Intergenic
1038218175 8:25582021-25582043 CTGGCTATGCCCGTAATCTTAGG + Intergenic
1038786575 8:30622672-30622694 CTGGCTGTGGCCATCTTCTATGG - Intronic
1038977911 8:32721748-32721770 CTGGCTCTGAACCTTTCCTTTGG + Intronic
1041344757 8:56885476-56885498 CTGGCACTGACCTATTTCTTAGG + Intergenic
1041499905 8:58529416-58529438 CTGGCTCTGGATCTCTTCTTTGG - Intergenic
1041765389 8:61413381-61413403 CTGGCTCTGGGTCTCTTCTTTGG - Intronic
1042807065 8:72782447-72782469 CTGGCTCTGGGTCTCTTCTTTGG + Intronic
1043236345 8:77872783-77872805 ATGTCTCTGTCCCTCTTCTTGGG - Intergenic
1046112337 8:109740178-109740200 CTGTCTCTGTGCTTCTTCTTGGG + Intergenic
1046754973 8:117963407-117963429 CTGGCTCTGAGTCTCTTCTTTGG + Intronic
1046758023 8:117991492-117991514 CTGGTTCTGAGTCTCTTCTTTGG + Intronic
1047093051 8:121594652-121594674 CTGGCTCTGCACCTCTTCTTTGG - Intergenic
1047588528 8:126301408-126301430 CTGGCTGTGACTGTGTCCTTGGG + Intergenic
1048332084 8:133477695-133477717 CTGGCTCTCACCGACACCTTGGG + Intronic
1050124164 9:2339328-2339350 CTGGCTCTGCGCCTCTTCTTTGG - Intergenic
1051171043 9:14317619-14317641 ATGGCTTTGACTGTCTTCTCAGG + Intronic
1051768173 9:20547020-20547042 CTGGCTCTGGGTCTCTTCTTTGG + Intronic
1055238974 9:74160890-74160912 CTGTCTCTGAGCCTCTTCATTGG + Intergenic
1055399449 9:75907690-75907712 CTGGCTGTGACCATCTCCTTGGG + Intronic
1055597892 9:77884119-77884141 GTAGCTCTGAGCATCTTCTTGGG - Intronic
1059276582 9:113102529-113102551 CTGGCTCCTAACATCTTCTTTGG + Intergenic
1061762462 9:132859999-132860021 ATGGCTCTGACCATGTCCTTGGG + Intronic
1186405521 X:9298882-9298904 CTGCCTCTGCCCTTCTGCTTTGG - Intergenic
1187116277 X:16355176-16355198 CTGGCTCTTGCCCTCTTCTCTGG - Intergenic
1187135467 X:16543376-16543398 CTGGCTCTGACCCTTTTCCTCGG + Intergenic
1190285145 X:48956843-48956865 CTGGGCCTGACAGTCTTCTCTGG - Intronic
1192543441 X:71994048-71994070 CTTTCTCTGACCCTCTCCTTAGG + Intergenic
1193928822 X:87526788-87526810 ATAGCTCTGACCTTCTTTTTTGG - Intronic
1198758537 X:140006371-140006393 CTGGCTCTGGGTCTCTTCTTTGG + Intergenic
1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG + Exonic
1200176697 X:154122103-154122125 CTGGTTCTGCCTGTCTTCTGTGG + Intergenic
1200852740 Y:7902439-7902461 CTGGTTCTGAGTCTCTTCTTTGG - Intergenic