ID: 917083817

View in Genome Browser
Species Human (GRCh38)
Location 1:171285353-171285375
Sequence CCATACCAGTTCCGCTTGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917083811_917083817 16 Left 917083811 1:171285314-171285336 CCACATCTGGCTCTGACCGTCTT 0: 1
1: 0
2: 1
3: 19
4: 263
Right 917083817 1:171285353-171285375 CCATACCAGTTCCGCTTGACTGG 0: 1
1: 0
2: 0
3: 0
4: 32
917083810_917083817 26 Left 917083810 1:171285304-171285326 CCTAACGGATCCACATCTGGCTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 917083817 1:171285353-171285375 CCATACCAGTTCCGCTTGACTGG 0: 1
1: 0
2: 0
3: 0
4: 32
917083813_917083817 0 Left 917083813 1:171285330-171285352 CCGTCTTCTTTGGCCCATGCTCA 0: 1
1: 0
2: 1
3: 17
4: 236
Right 917083817 1:171285353-171285375 CCATACCAGTTCCGCTTGACTGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917083817 Original CRISPR CCATACCAGTTCCGCTTGAC TGG Exonic
917071971 1:171161199-171161221 CCATACCAGTTTCGACTGATGGG + Exonic
917083817 1:171285353-171285375 CCATACCAGTTCCGCTTGACTGG + Exonic
1064932547 10:20643155-20643177 CCAGAGCATCTCCGCTTGACTGG - Intergenic
1070987174 10:80699184-80699206 ACATACCATTTCCTCTGGACAGG - Intergenic
1074681205 10:115909521-115909543 CCAAACCAGATCTGCTTGCCAGG + Intronic
1089414057 11:118272294-118272316 CCATACCAGTTCAGGTACACTGG - Intergenic
1109526724 13:63585315-63585337 CCATCACAGTTCCACATGACTGG + Intergenic
1110858950 13:80326852-80326874 CCCTATCAGTTCCCCTTGTCAGG - Intergenic
1112420089 13:99240750-99240772 CCATCCCAGTTCAGCTGGGCTGG + Intronic
1119064227 14:71509883-71509905 TCATGCCAGTTCAGGTTGACTGG + Intronic
1119450576 14:74706331-74706353 CCATTCCAGTTCCACCCGACTGG - Intronic
1124692707 15:31838959-31838981 CCATAACAGATCCGATGGACTGG + Intronic
1133602088 16:7349618-7349640 ACATACCACATCCGCTTGAGAGG + Intronic
1152271924 17:79329787-79329809 CCATCCCGGTTCCTCTTCACCGG + Intronic
1165059925 19:33200137-33200159 CCATACCACTTCAGCCTCACTGG + Intronic
934092333 2:88563187-88563209 CCATACCAGTACTTCTTAACTGG + Intronic
1184100610 22:42340111-42340133 CCTTACCTGTTCTGCTTCACTGG + Intronic
1203314510 22_KI270736v1_random:173925-173947 CCATTCCATTTTCGTTTGACAGG - Intergenic
952073224 3:29664580-29664602 TCATACCATTTCCATTTGACTGG - Intronic
954876119 3:53804202-53804224 CCATTCCACTTCCACTTCACTGG - Intronic
972462129 4:39314593-39314615 CCAAACAAGTTCTGCTTGAGAGG - Intronic
974134908 4:57803375-57803397 GCATACCAATTCTGCTTGAGAGG - Intergenic
976619269 4:87111766-87111788 CCCTACCTGTTCCCCTTGTCTGG + Intronic
986625861 5:9723480-9723502 CCACACCTGTTCCCCATGACTGG + Intergenic
1004324251 6:14659507-14659529 CCATTCCAGTTCTCCTTGCCTGG - Intergenic
1005611300 6:27527551-27527573 CCTGGCCATTTCCGCTTGACTGG - Intergenic
1007757163 6:44107343-44107365 CCATACCTGTCCCGCCTGAGGGG - Intergenic
1040446078 8:47494935-47494957 CTATACCACTTCCCCTTCACTGG - Intronic
1045846202 8:106639139-106639161 TCATACCACTTCAGGTTGACTGG + Intronic
1188260943 X:28023241-28023263 CTATACCAGTTGCTTTTGACAGG - Intergenic
1196627611 X:117894520-117894542 CCATACCAGATTTGGTTGACAGG - Intergenic
1200240367 X:154490173-154490195 CCACACCATTTCTGCTTGAGGGG + Intronic
1200535162 Y:4389193-4389215 CCAATCCAATTCCTCTTGACTGG - Intergenic