ID: 917086995

View in Genome Browser
Species Human (GRCh38)
Location 1:171313602-171313624
Sequence TCTTACAAGCACACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917086989_917086995 30 Left 917086989 1:171313549-171313571 CCATGTTGGAAAATGTCCCTAAA 0: 1
1: 0
2: 0
3: 23
4: 203
Right 917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 167
917086990_917086995 14 Left 917086990 1:171313565-171313587 CCCTAAACACAAGTCCTAAAGAT 0: 1
1: 0
2: 1
3: 10
4: 156
Right 917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 167
917086993_917086995 0 Left 917086993 1:171313579-171313601 CCTAAAGATGGTCTGTTATATTA 0: 1
1: 0
2: 1
3: 12
4: 198
Right 917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 167
917086991_917086995 13 Left 917086991 1:171313566-171313588 CCTAAACACAAGTCCTAAAGATG 0: 1
1: 0
2: 0
3: 10
4: 216
Right 917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917086995 Original CRISPR TCTTACAAGCACACAGTGGA AGG Intergenic
901378567 1:8857294-8857316 GCTTTCAAGGACACAGTGGGAGG - Intergenic
901909138 1:12440517-12440539 TCTTACAAGAGCACAGAAGAAGG + Intronic
902594944 1:17502996-17503018 TTTGACACGCACACAGTGGTTGG - Intergenic
902623523 1:17664090-17664112 TCTTCCCAGCACCCAGTGCATGG + Intronic
904320761 1:29696695-29696717 TCTTAGAAGGACACAGAGGTGGG - Intergenic
905186092 1:36197902-36197924 TCTTAGAAGAAAACAGGGGAAGG - Intergenic
906847125 1:49205243-49205265 TCTTTCAAGGACACAGAGGAGGG + Intronic
909567939 1:77076712-77076734 TTTTACAAGGATGCAGTGGAAGG + Intergenic
909751408 1:79165829-79165851 TTTTCCAGGCACACAGTGCAAGG - Intergenic
910680561 1:89859843-89859865 TCTTGGAAGCACAAAATGGAAGG - Intronic
913393190 1:118337241-118337263 TCTAACAACGACAAAGTGGAAGG - Intergenic
915140177 1:153763045-153763067 TCTTACAAGCAAACAAGGGCAGG - Intronic
917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG + Intergenic
917124018 1:171670328-171670350 TTTTACAACCACACAGAGGAGGG + Intergenic
917159363 1:172040508-172040530 TCTTTCAAGCAGCCAGTGTAAGG + Intronic
917963328 1:180163022-180163044 TCTTAAAAGGAAACAGTGAAAGG - Intronic
921745283 1:218733404-218733426 TCTCACCAGCACTCAGTGGGAGG - Intergenic
922535434 1:226377070-226377092 TCCTAGAAGCAGACAGTGTAAGG + Intronic
923281957 1:232451947-232451969 TCTCAAAAGCATACACTGGAAGG + Intronic
924169975 1:241328725-241328747 TGTTACAAGAAGACAGTGTAAGG - Intronic
924217110 1:241834043-241834065 GCTTACAAGCAGACATTGAAAGG - Intergenic
1068698031 10:59989932-59989954 TCTTACCAGCAGAGAGGGGAAGG + Intergenic
1071962847 10:90823506-90823528 TTTTACAGGCTCATAGTGGAAGG + Intronic
1073366398 10:102945751-102945773 TCTTACAATAACACAGAAGAGGG - Intronic
1074490380 10:113934552-113934574 TCTTACAAGGACACAGTCATTGG - Intergenic
1075875545 10:125803070-125803092 TTTTAGAAGCACACAGAGCAAGG + Intronic
1080086041 11:28283524-28283546 TCTAATAAGTACACAGTGAATGG + Intronic
1082795988 11:57378121-57378143 TCTAACAAGCTCCCAGGGGATGG + Intronic
1083753067 11:64773049-64773071 TCTCACAGGTACACAGTGCAGGG - Intronic
1084784326 11:71433395-71433417 TTGTACAAACACACAGTGCATGG + Intronic
1087962130 11:104365457-104365479 TATTTTAAGTACACAGTGGATGG + Intergenic
1088040480 11:105375475-105375497 TCTTGCAGGCACGCAGTGAAAGG + Intergenic
1092682012 12:10993859-10993881 TCTCACAAGCCCACAGGAGAGGG + Intronic
1093824177 12:23661764-23661786 TGGTTCAAGTACACAGTGGATGG - Intronic
1095661304 12:44740334-44740356 TTATACCAGCACACAGAGGAGGG + Intronic
1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG + Intronic
1098361416 12:69657899-69657921 TCTGACCCTCACACAGTGGAGGG - Intronic
1098931636 12:76423235-76423257 TCTTTCAAGCACAACGTTGATGG + Intronic
1099075414 12:78102146-78102168 TTTTACAGGCTCATAGTGGAAGG - Intronic
1100927671 12:99567948-99567970 TCTGAAAACCTCACAGTGGAAGG - Intronic
1101208001 12:102508128-102508150 TTTGACTAGCACAGAGTGGAGGG + Intergenic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1103334473 12:120178886-120178908 TCCCACAAGCACGCCGTGGATGG - Exonic
1106093701 13:26623214-26623236 TCTTAAGAGTACCCAGTGGAGGG - Intronic
1106570129 13:30919746-30919768 TCTAAAAATCACACAGTGGCTGG + Intronic
1106797068 13:33217522-33217544 TGGTGCAAGCACACAGGGGAAGG + Intronic
1107235182 13:38160042-38160064 AATTAAAAACACACAGTGGAGGG - Intergenic
1108262044 13:48668055-48668077 TCTGACAAGCACATATTTGAGGG - Intronic
1110285645 13:73747219-73747241 CCTTACATGCACACAATTGAGGG + Intronic
1111046851 13:82824876-82824898 TCTGAGGTGCACACAGTGGATGG - Intergenic
1112690163 13:101884253-101884275 TGATACAAACACACAGTGAAGGG + Intronic
1114571549 14:23672679-23672701 TCTTCAAAGCCCACAGTGGCTGG + Intergenic
1117367685 14:55046880-55046902 CCTTACAAAGACACAGAGGAAGG - Exonic
1121102684 14:91260982-91261004 TCTTTAAAGCTGACAGTGGATGG - Intergenic
1121835703 14:97090188-97090210 TCTGACTAGCACAAAGTGTAAGG - Intergenic
1122944017 14:104996894-104996916 TCTGGCAACCTCACAGTGGAAGG + Intronic
1125432063 15:39605507-39605529 TCTAACAAGCTCCCAGTGGTTGG + Intronic
1126312729 15:47335859-47335881 TCTTACTACAACACTGTGGAAGG + Intronic
1126351987 15:47753409-47753431 GCTGACAAGGACACAGAGGATGG + Intronic
1126897265 15:53272350-53272372 TCTTATTAGCACTCAATGGAGGG + Intergenic
1128156061 15:65392583-65392605 TTCTACAAGCACAGAGTGCAGGG + Intronic
1129653891 15:77510180-77510202 TCTTCCAAACACTCACTGGAAGG + Intergenic
1134381251 16:13728534-13728556 TCTTCCAAGCATACATTGGGAGG - Intergenic
1140554347 16:75904312-75904334 TCATACAAACACACCCTGGAGGG + Intergenic
1144552207 17:16250765-16250787 TCTTACAGAGACACAGTGGGAGG + Intronic
1148874591 17:50679437-50679459 TCTAACAAGCTCCCAGAGGATGG - Intronic
1149282600 17:55124883-55124905 TTGTACATGCACACAGAGGAGGG + Intronic
1153197737 18:2619468-2619490 TCTAACAAGCTCACAGGTGATGG - Intergenic
1153795641 18:8619433-8619455 TCTTACAAGCACTAAGTCCAGGG + Intronic
1155051803 18:22154974-22154996 TCCTTCACCCACACAGTGGATGG - Intergenic
1155056591 18:22189113-22189135 TCCCAGAAGCACACAGGGGACGG - Intronic
1155475170 18:26230508-26230530 TCTGAAAATCAAACAGTGGATGG - Intronic
1155553921 18:26996732-26996754 ACATACATGCACACTGTGGAGGG - Intronic
1160989107 19:1853387-1853409 TCTTCCAAGCACCCAGGAGAAGG + Exonic
1165857096 19:38885883-38885905 TCTTAAAAGAAAACAGTGGCCGG - Intronic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
931009508 2:57892855-57892877 TTTTTCAAGCACACTTTGGAAGG - Intergenic
931180526 2:59895758-59895780 TCTAACAAGCACACAGGGCCAGG + Intergenic
932317974 2:70798824-70798846 TTTTCCAGGCACACAGTGCAAGG + Intergenic
935152690 2:100451735-100451757 TCTAACAAATACACAGGGGAAGG - Intergenic
937607236 2:123815739-123815761 TCTTACAAGCACAGAGTAAAAGG - Intergenic
937771133 2:125721868-125721890 TCTTAGAAGGACACAAGGGATGG - Intergenic
938451979 2:131429184-131429206 TCTTACAAACAGGCAGTGTATGG + Intergenic
938588574 2:132715701-132715723 TCTGACAAAGACACCGTGGAGGG + Intronic
939877452 2:147594042-147594064 TCTTCGAAGCCCAAAGTGGAGGG + Intergenic
941372054 2:164677753-164677775 CCTTCCAAGAACACAGTGCAGGG + Intronic
942033135 2:171983692-171983714 TCTTAGAAGCAAAGTGTGGAAGG - Intronic
942180200 2:173373077-173373099 TCTCAAAAAAACACAGTGGATGG - Intergenic
944873685 2:203939828-203939850 TCTAACAAGAACACTCTGGAAGG - Intronic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
948768607 2:240236057-240236079 TCTTCCATGCTCACAATGGAAGG + Intergenic
1170830000 20:19832061-19832083 TCTCACCACCACACAGTGTACGG - Intergenic
1171244472 20:23600272-23600294 TCTAACCAGCACACAGGGAATGG + Intergenic
1172926198 20:38538261-38538283 TCTTAGCAGCACATGGTGGATGG - Intronic
1173634285 20:44541248-44541270 TCTTAAAAGCACACAGCTGATGG - Intronic
1174145627 20:48450546-48450568 ACTTAAAACCACACAGTGTAAGG + Intergenic
1174229711 20:49035819-49035841 TCTTAACAACAAACAGTGGATGG + Exonic
1175326769 20:58135017-58135039 TCTGAAAAGCACACACTGTATGG + Intergenic
1175533666 20:59692168-59692190 TCTTACAAGTACCCAGGGCATGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184173307 22:42772164-42772186 TGTTAGAAGGACACAGGGGAGGG + Intergenic
1184355790 22:43978772-43978794 TCTTCCCAGCACCCAGTGGCTGG + Intronic
1184797973 22:46742711-46742733 GCTTACCAGCACCCAGGGGAGGG + Intergenic
952898247 3:38093471-38093493 TCCTGCAAGCTCACACTGGAGGG - Intronic
956475000 3:69610290-69610312 TTTTCCAAGCACACAGTGCGAGG - Intergenic
956938493 3:74131324-74131346 TTTTACAGGCTCATAGTGGAAGG - Intergenic
957298960 3:78366314-78366336 TGTTAGGAGCACACAGTGGGTGG + Intergenic
959348655 3:105232338-105232360 TCCTTCAATAACACAGTGGATGG - Intergenic
959859665 3:111203230-111203252 TCCTACAAGCATCCAGTGGGAGG + Intronic
960127842 3:114019858-114019880 TGTTATAGGAACACAGTGGATGG - Intronic
962195511 3:133359377-133359399 TCTTACAAGTACAGAGTGATGGG + Intronic
963286259 3:143437306-143437328 GCTTGCAAGCAAACAGAGGAAGG - Intronic
965726160 3:171718706-171718728 TCTTACAAGCAGTGAGTGGCAGG - Intronic
967140180 3:186551124-186551146 TCTTACATGCAGACACTGGTAGG - Exonic
971032011 4:22648412-22648434 TCATAGAAGCACAGAGTAGAAGG - Intergenic
971086080 4:23276702-23276724 TCTTACAAGGGCACAGTTCATGG - Intergenic
971901557 4:32665686-32665708 CCTTACTAGCACACAGGTGAAGG - Intergenic
972230535 4:37067643-37067665 TATTATAAGCACACAGTAAAAGG + Intergenic
973823768 4:54685220-54685242 TCTTACTGGCACACAGAGGGTGG - Intronic
976019759 4:80607384-80607406 TCTTAAAAGCAAAAAGTAGAGGG + Intronic
976511455 4:85914361-85914383 TCTTAAAAGCACAGATTGCAGGG + Intronic
977438367 4:97030722-97030744 TCTTACAAACAAATATTGGAAGG - Intergenic
979669108 4:123343581-123343603 CCTTCCAAGCACACAGGGCACGG + Intergenic
987256237 5:16154893-16154915 TCATACCAGCACACTGTTGATGG + Intronic
987316441 5:16728978-16729000 TCTTTTAAGCACAGCGTGGAAGG + Intronic
988519861 5:31936024-31936046 TCTTACAAACACAGCGTGGCTGG + Intronic
991089903 5:62684257-62684279 TGCTACAAGAGCACAGTGGAGGG - Intergenic
991400084 5:66242734-66242756 TCTTTAAAGCACACAATAGAGGG - Intergenic
992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG + Intronic
995233543 5:109799070-109799092 TATTACCATCACCCAGTGGAGGG - Intronic
997215319 5:132105094-132105116 TCTTGTAACCATACAGTGGATGG - Intergenic
999071873 5:148752027-148752049 TCTTAGAAGCAGACAATGAATGG - Intergenic
999697139 5:154197147-154197169 GCTTGCCAACACACAGTGGAGGG + Intronic
1000039852 5:157477501-157477523 ACATACAAACGCACAGTGGACGG + Exonic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1004240152 6:13913991-13914013 CCTTACAAGCACAAAATGGCTGG - Intergenic
1006171925 6:32098002-32098024 CTTTACGAGCACACAGTGGAAGG - Intronic
1007196610 6:40066868-40066890 TCTGACTAGGACACTGTGGAGGG + Intergenic
1010133286 6:72521268-72521290 TCTGAGAAGCACGCAGGGGAAGG - Intergenic
1011378551 6:86718336-86718358 TTTTACAGGCTCATAGTGGAAGG - Intergenic
1011789153 6:90879309-90879331 TCATACAAGCTCCCAGTGTAGGG + Intergenic
1013288732 6:108701774-108701796 ACTAGGAAGCACACAGTGGAAGG + Intergenic
1014847149 6:126291423-126291445 TCTTTCAAGAACTAAGTGGATGG + Intergenic
1020280145 7:6646188-6646210 TCCTACAATGACACAGAGGAGGG - Intronic
1021549648 7:21856407-21856429 TCTAACAAGCACAGTGTGGTTGG + Intronic
1022307965 7:29167770-29167792 GCTTCCAAGCACATAGTAGAAGG + Intronic
1023020412 7:36007021-36007043 GCTTCCAAGCACCCAGTGGGAGG + Intergenic
1025765736 7:64446365-64446387 TCTTAGAAACAAACAGTGAAAGG + Intergenic
1027006654 7:74699685-74699707 TCTTACAAGAAAACAGTCAAAGG + Intronic
1027829265 7:83156231-83156253 TCTTTCAAGCTAATAGTGGAAGG + Exonic
1033477587 7:141705653-141705675 TCCCTCAAGCACACAGTTGAGGG + Intergenic
1034270534 7:149801598-149801620 TCTCACCAACACATAGTGGAAGG + Intergenic
1038982588 8:32776218-32776240 TCTGACAAGCACAGATTGGCAGG - Intergenic
1039796364 8:40918840-40918862 TCTGAAAAAAACACAGTGGAAGG + Intergenic
1041480948 8:58319074-58319096 TTTCCCAAGCACACAGTCGATGG + Intergenic
1046046169 8:108967394-108967416 TTTTTAAAGCACAAAGTGGAAGG + Intergenic
1046681300 8:117173035-117173057 TCTTACTAGAAATCAGTGGAAGG + Exonic
1047144994 8:122188533-122188555 TCTTGCAAGCTTACAGTGCATGG + Intergenic
1048694715 8:137012988-137013010 TTTTTCAGGCACACAGTGAAAGG + Intergenic
1048762102 8:137806076-137806098 TCTAACAAGCTCACAGGAGATGG + Intergenic
1049625890 8:143620566-143620588 TCTCTGAAGCACAGAGTGGATGG + Intergenic
1050098015 9:2087641-2087663 TCTTAAGAGAAGACAGTGGAAGG - Intronic
1052750787 9:32487735-32487757 TTTTACTAACACACAGTGTATGG + Intronic
1055178426 9:73350920-73350942 TCATAGAAGCAGACAGTAGAAGG - Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1058539055 9:105993119-105993141 TCTTACAAGCTCAGAGTGCATGG + Intergenic
1059221352 9:112623159-112623181 ACCTACATGAACACAGTGGATGG - Intronic
1059537058 9:115090738-115090760 TTTCAGGAGCACACAGTGGATGG - Exonic
1062082545 9:134631952-134631974 TCTTACAAGGACACCTGGGATGG - Intergenic
1186424749 X:9455151-9455173 TTCTACAAGCCCACTGTGGAAGG + Intergenic
1190594991 X:52043527-52043549 TCTTACAGGAACAAAGAGGAGGG - Intergenic
1190613833 X:52210546-52210568 TCTTACAGGAACAAAGAGGAGGG + Intergenic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1198676676 X:139138599-139138621 TCTTACAGACACACAGTACAGGG + Intronic