ID: 917087316

View in Genome Browser
Species Human (GRCh38)
Location 1:171316916-171316938
Sequence TCTCTTAGATTTTGTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 2, 2: 3, 3: 43, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917087313_917087316 -10 Left 917087313 1:171316903-171316925 CCAGTCAGTAAATTCTCTTAGAT 0: 1
1: 1
2: 0
3: 6
4: 163
Right 917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG 0: 1
1: 2
2: 3
3: 43
4: 267
917087312_917087316 -7 Left 917087312 1:171316900-171316922 CCTCCAGTCAGTAAATTCTCTTA 0: 1
1: 0
2: 1
3: 10
4: 151
Right 917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG 0: 1
1: 2
2: 3
3: 43
4: 267
917087311_917087316 -6 Left 917087311 1:171316899-171316921 CCCTCCAGTCAGTAAATTCTCTT 0: 1
1: 0
2: 0
3: 24
4: 289
Right 917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG 0: 1
1: 2
2: 3
3: 43
4: 267
917087310_917087316 23 Left 917087310 1:171316870-171316892 CCTGGAGGACTCAGGAGTCTTTC 0: 1
1: 0
2: 3
3: 11
4: 197
Right 917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG 0: 1
1: 2
2: 3
3: 43
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917087316 Original CRISPR TCTCTTAGATTTTGTGCCTG GGG Intronic
901897822 1:12329596-12329618 CCTCTTAAACTCTGTGCCTGAGG - Intronic
902318979 1:15646342-15646364 GCTCTAAAATTTTGTTCCTGTGG + Intronic
905099648 1:35508129-35508151 CTCCTTAAATTTTGTGCCTGAGG - Intronic
906480171 1:46194456-46194478 TTCCTTTGATTGTGTGCCTGGGG - Intronic
907032185 1:51183463-51183485 TGTTTTAGTTTTTGTGACTGAGG - Intergenic
908828046 1:68152388-68152410 ACTCTTAGACTTTGGGACTGGGG - Intronic
908890165 1:68837352-68837374 TCTTGAAGATTTTGTGCTTGTGG + Intergenic
908918381 1:69159584-69159606 TCCCTTAAATTTTGTGCTTGAGG - Intergenic
910709352 1:90163405-90163427 TCTCTTAACTTTTGGGCCTCAGG + Intergenic
913492143 1:119390878-119390900 TCCCCTAGAGTCTGTGCCTGAGG - Intronic
917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG + Intronic
917242878 1:172968059-172968081 TCTCTGAGTTTTTTTGCCTTTGG - Intergenic
919170547 1:193948638-193948660 CCTCTTAAATTTTGTGCCCTAGG - Intergenic
920031245 1:203038666-203038688 TCTCTTAGACTGAGTGCCGGAGG - Intronic
920204517 1:204281971-204281993 TCTCTTCTATCTTCTGCCTGTGG - Intronic
922506798 1:226131016-226131038 CCTGTTACATTTTGTGCCTGAGG - Intergenic
922814075 1:228436889-228436911 CCTCTTGGTGTTTGTGCCTGTGG + Intergenic
924132373 1:240924787-240924809 TCCCTTAGATTTTGCACCTGAGG - Intronic
924899831 1:248385731-248385753 TCTCCTATTGTTTGTGCCTGTGG + Intergenic
1062900304 10:1139373-1139395 TCTGTCAGATTTTGTACCTTGGG + Intergenic
1065284982 10:24179008-24179030 CCTCTTAGATTCAGTGGCTGGGG + Intronic
1065918845 10:30373736-30373758 TCTCTTAATTCTAGTGCCTGGGG + Intronic
1066362468 10:34744679-34744701 TCCCTTAAATTTTGTGTCAGAGG - Intronic
1068299345 10:55118526-55118548 TGTCTTAGAATTTGTGCATGTGG + Intronic
1068413842 10:56691195-56691217 CCACTTAGATGATGTGCCTGAGG - Intergenic
1069037002 10:63656089-63656111 GCTGGTAGATTCTGTGCCTGGGG - Intergenic
1072411820 10:95209609-95209631 CCTTTTACATTTTGTGCCTGAGG - Intronic
1073139922 10:101240248-101240270 TCCCTTAGGTTTTGTGCCGTGGG + Intergenic
1073604093 10:104876465-104876487 GGTCTTTGATATTGTGCCTGTGG - Intronic
1074760603 10:116664716-116664738 TCCCTTTGACCTTGTGCCTGGGG + Intronic
1074844628 10:117386712-117386734 CCTCTTAAATTTTGTGCCCAAGG + Intergenic
1075498278 10:122947378-122947400 TCATTTAGATTTTGTACATGAGG + Intronic
1075990859 10:126837401-126837423 TCTCTCAGAAGCTGTGCCTGTGG - Intergenic
1076136889 10:128051293-128051315 TGTCTTAAATTATGTGCCTGGGG - Intronic
1076433964 10:130426933-130426955 TGTCTTATATTTTGTACCTGTGG + Intergenic
1077639002 11:3864320-3864342 TCTCATAGATTCTGTGCATCGGG + Intronic
1078435676 11:11323286-11323308 TCTCTTCGAATGTGAGCCTGTGG + Intronic
1078506899 11:11958549-11958571 TCTCTTATCTTTTGAGGCTGAGG + Intronic
1079381604 11:19943068-19943090 GCTATTATATTTTGTGCGTGTGG + Intronic
1079553794 11:21734731-21734753 TCTCTAAGATTTTCTTCCAGTGG + Intergenic
1080319539 11:30990492-30990514 TCTCTTATATTTTTTGGCTGTGG - Intronic
1080394475 11:31877127-31877149 TTTCTGAGGTTTTTTGCCTGTGG + Intronic
1080588670 11:33702723-33702745 TCTCTTAGGTTCAGAGCCTGGGG - Intronic
1081687234 11:45051584-45051606 TCTCTTTCTTTTTGTCCCTGTGG - Intergenic
1083027073 11:59559976-59559998 TCTCTCCGATTGGGTGCCTGAGG - Intergenic
1085191662 11:74631012-74631034 GCTCTTAGATTTTTTTCCTCTGG + Intronic
1087292255 11:96332451-96332473 TCCCTTAGATTCTTTGCATGTGG - Intronic
1088198405 11:107302014-107302036 TCCCTTATATTTTGTGCCTGAGG + Intergenic
1088546298 11:110962775-110962797 TCTCCTAGATTCTCTGGCTGGGG - Intergenic
1089600305 11:119610275-119610297 TACCTTACATTCTGTGCCTGCGG + Intergenic
1093301711 12:17466599-17466621 TCTCTTAGTTTTTGTGTGTCTGG - Intergenic
1094206405 12:27844865-27844887 TCTCTTCGATTTCGTCCCTTAGG + Intergenic
1094219100 12:27974403-27974425 TTTCTTAAATTTTGAGCCGGGGG + Intergenic
1095316608 12:40769736-40769758 TCCCTTAAATTTTGCACCTGAGG + Intronic
1095592900 12:43924831-43924853 TCTCATAGTTTCTGTGCGTGAGG + Intronic
1095750552 12:45705769-45705791 TCTCATAGCATTTGTGACTGTGG + Intergenic
1100949752 12:99833659-99833681 TCTTTTCCATTTTTTGCCTGAGG - Intronic
1100957390 12:99924033-99924055 ACTCTTAAATTTTATACCTGTGG + Intronic
1101793261 12:107950062-107950084 CCCTTTAAATTTTGTGCCTGAGG + Intergenic
1101927129 12:108981423-108981445 TCTCTTAGATTTGGAATCTGAGG + Intronic
1102553013 12:113705816-113705838 TCTCTTAGGTTGGGTGTCTGCGG - Intergenic
1103315240 12:120049109-120049131 TCTGCTAGAGTTTGTGCCTGGGG + Intronic
1103386697 12:120538345-120538367 TCTTTGAGATTTTGTTCCAGTGG + Intronic
1104283285 12:127398059-127398081 TCTCATAGAATTTGTGGATGGGG + Intergenic
1106341214 13:28828690-28828712 TCCCTTAAATTTTGTACCTGAGG - Intronic
1106975931 13:35214854-35214876 TGACTTAGTTTTTGTGTCTGTGG + Intronic
1107801636 13:44113799-44113821 CCTTTTAAATTTTGTGTCTGAGG + Intergenic
1108057981 13:46504187-46504209 TTTCTTATATTTTGTGCATCAGG + Intergenic
1108625050 13:52219979-52220001 TCTCTTTTAATTTATGCCTGAGG + Intergenic
1108661005 13:52586439-52586461 TCTCTTTTAATTTATGCCTGAGG - Intergenic
1116150284 14:41131519-41131541 GCTCTTTGATTTTTTTCCTGAGG + Intergenic
1117220268 14:53597175-53597197 ACTTTTAGATTTTGGCCCTGTGG + Intergenic
1118971025 14:70638100-70638122 ACTCTTAGATTTTGGGTTTGAGG - Intergenic
1119432883 14:74579702-74579724 TCTCTGAGTTTTTGTCCGTGGGG - Intronic
1120204874 14:81577050-81577072 CCTATTAGATTTTGGGCTTGTGG + Intergenic
1121674216 14:95739381-95739403 TCTCTCAGGTTCTGTGGCTGGGG - Intergenic
1122428387 14:101624668-101624690 TCTCTGAGCCTTTGTTCCTGAGG - Intergenic
1123431108 15:20217241-20217263 CCCCTTATATTTTCTGCCTGAGG - Intergenic
1125430068 15:39584627-39584649 TCTCTTAGATACTTAGCCTGGGG - Intronic
1125789492 15:42352929-42352951 TCCCTTACATTTTGTGCCCAAGG - Exonic
1127400695 15:58582439-58582461 TTTCTTAAATTTTGTGCCCTAGG + Intergenic
1130365851 15:83237875-83237897 TCTCTTAGATTTTGTTTGTCTGG - Intergenic
1131035685 15:89220587-89220609 TGGCTTAGATTTGGTTCCTGTGG - Intronic
1132145181 15:99425342-99425364 TCTGTCAGATTTTGAGGCTGAGG - Intergenic
1134565538 16:15248849-15248871 TCTCTTAGGATTTGTTTCTGGGG - Intergenic
1134736958 16:16507849-16507871 TCTCTTAGGATTTGTTTCTGGGG + Intergenic
1134930557 16:18204320-18204342 TCTCTTAGGATTTGTTTCTGGGG - Intergenic
1135184081 16:20299739-20299761 TCCCTTAGATTTGGTAACTGAGG + Intergenic
1136525193 16:30825181-30825203 TCTCTTACAATTTCTGCCTTTGG + Intergenic
1136853541 16:33634006-33634028 CCCCTTATATTTTCTGCCTGAGG + Intergenic
1138184326 16:54964589-54964611 TCTCTTAGAATCTGTCCCCGTGG + Intergenic
1138649637 16:58451953-58451975 CCTCCTAGATTTTCTGGCTGGGG + Intergenic
1140028347 16:71312354-71312376 TCTCTTTGTTTTTATGCCTGAGG + Intergenic
1141013433 16:80425022-80425044 TCTCTTTGCTTTTGTGCCCTTGG - Intergenic
1141427033 16:83951308-83951330 CCCCTAAAATTTTGTGCCTGAGG - Exonic
1203115135 16_KI270728v1_random:1482451-1482473 CCCCTTATATTTTCTGCCTGAGG + Intergenic
1143604266 17:7972384-7972406 TCTCTTAGACTTAGTTCCTCAGG - Intergenic
1144705640 17:17366014-17366036 TCTCATAATTTTTGTGCCTAAGG - Intergenic
1146124284 17:30219694-30219716 TCTCCTGGATCTTGTGGCTGAGG + Intronic
1147870820 17:43586217-43586239 CCCCTTACATTTTGGGCCTGTGG - Intergenic
1148902793 17:50891156-50891178 TCCCTTAAATTTTGTGCCTAAGG + Intergenic
1149010170 17:51848050-51848072 CCTCTTAAATTTTGTGCCCAAGG - Intronic
1150009109 17:61488265-61488287 TCTCTCGGCTTCTGTGCCTGTGG - Intergenic
1150337047 17:64338004-64338026 TCTCTTAGGTTTTCTGACTGGGG - Intronic
1150982056 17:70153947-70153969 CCTCTTAAATTTTATACCTGAGG + Intergenic
1152710882 17:81870136-81870158 TGTCTTAGATGTTATACCTGGGG - Intronic
1154374827 18:13800609-13800631 TCTCTTACATTTTGTGCCTGGGG + Intergenic
1155679091 18:28467506-28467528 TCTCTCAGGTTCTTTGCCTGAGG - Intergenic
1156505354 18:37587211-37587233 TCTCTTAGGTTTTATCCCTGAGG + Intergenic
1157151076 18:45218860-45218882 TCTCAGAGATTTAGTGCATGTGG - Intronic
1158462374 18:57657747-57657769 TCTCTTGGCTTATGTGGCTGAGG + Intronic
1158677235 18:59531455-59531477 TCTCATAATTTTTGTTCCTGGGG - Intronic
1159588414 18:70304832-70304854 TCTCTTATATATTGTGCTTTTGG + Intronic
1160034091 18:75285440-75285462 TCTCCTAGCTTATGTTCCTGAGG + Exonic
1160382567 18:78471792-78471814 CCTCTTAAATGTTGTGCCTGAGG - Intergenic
1161867803 19:6847599-6847621 TCACTTACATTTTGCACCTGAGG + Intronic
1162610612 19:11747339-11747361 TTTCATACATTTTGTGCTTGTGG - Intergenic
1166417567 19:42607173-42607195 TCACTCAGGATTTGTGCCTGAGG + Intronic
926481278 2:13398962-13398984 ACTCTTAGCTTTTGTGCATTGGG + Intergenic
928813137 2:35253841-35253863 TCTTTTAGCTTTGCTGCCTGTGG - Intergenic
931579262 2:63755100-63755122 TCTCTTAGATTACTTTCCTGAGG - Intronic
932080094 2:68706324-68706346 TCTTTCAGATTCTGTGCCTAAGG + Intronic
932917996 2:75877802-75877824 TCTCCTAATTTTAGTGCCTGAGG - Intergenic
933599579 2:84315956-84315978 TTTCTCAGAATTGGTGCCTGGGG - Intergenic
933997682 2:87681868-87681890 TCTCTCTGCTTATGTGCCTGTGG + Intergenic
935213320 2:100956672-100956694 TCTCTTTGGTTTGGGGCCTGAGG - Intronic
935226545 2:101057893-101057915 TCTCCTAGATTTCATGGCTGGGG - Intronic
935885477 2:107614782-107614804 TATCTTAGATCTTGTACCTAGGG - Intergenic
936296172 2:111269002-111269024 TCTCTCTGCTTATGTGCCTGTGG - Intergenic
937091631 2:119210268-119210290 TCTATTTGATTTTGTGTCTATGG + Intergenic
937117448 2:119418379-119418401 TCTCTTAGGTTTGTTGACTGTGG + Intergenic
937840427 2:126519237-126519259 TCTTTTAGTTTTCCTGCCTGTGG - Intergenic
938973357 2:136452271-136452293 TCTCTTAAATTCTGTGCCTGGGG - Intergenic
939364689 2:141216588-141216610 TCTCAGAGATTGAGTGCCTGTGG - Intronic
944278882 2:197871635-197871657 TCTCCTAGTTTTGGTGACTGTGG + Intronic
944618121 2:201483352-201483374 TTTCTTAAATTTTGTGCCTCAGG + Intergenic
944629423 2:201608311-201608333 TCAGTTAAGTTTTGTGCCTGAGG - Intronic
944917590 2:204377012-204377034 TGCCTTAAATTTTGTGCCTGAGG - Intergenic
945244037 2:207701839-207701861 CCCCTTAGGTTTGGTGCCTGTGG - Intergenic
947603880 2:231471138-231471160 TCCCTTAAGTGTTGTGCCTGAGG - Intronic
947614925 2:231549744-231549766 TCTCTTAAATTTTCTACATGAGG - Intergenic
948539871 2:238683200-238683222 TCTCTTACAGTTTTTGCCTTGGG + Intergenic
948777563 2:240297601-240297623 CCTCATGGCTTTTGTGCCTGAGG - Intergenic
1168869496 20:1116331-1116353 TCTCTGAGATGTACTGCCTGTGG - Intronic
1169449077 20:5695936-5695958 TCTCTCAGATTTTGCTCTTGGGG + Intergenic
1169841944 20:9948145-9948167 TGTCTTTGATTTTGAGCCTCTGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170468018 20:16640442-16640464 ACTCTTAGGTTTGGTGCCTGAGG + Intergenic
1170604029 20:17862740-17862762 TCTCTGAGATTCTCTCCCTGTGG - Intergenic
1173228846 20:41178561-41178583 TTTCCTAGATTTTGTATCTGTGG - Exonic
1174150351 20:48481975-48481997 CCATTTAGATTTTATGCCTGGGG - Intergenic
1174945652 20:54982508-54982530 CCCCTTAAATTTTGTGCCTGTGG - Intergenic
1175008021 20:55706307-55706329 GCCCTTATATTTTGTGCCTAAGG - Intergenic
1177803773 21:25854183-25854205 TCCCTTAAATTTTGTTCCTGAGG - Intergenic
1178289059 21:31350931-31350953 TTTAATTGATTTTGTGCCTGTGG - Intronic
1178358047 21:31924647-31924669 TCTCATAGATCTTGTGCATCAGG - Exonic
1179275819 21:39890771-39890793 CCTCTTAAATTTTGTGCCCAGGG + Intronic
1180624178 22:17182870-17182892 TCTCTTCATTTTTGTGCTTGGGG - Intronic
1182260011 22:29067302-29067324 CCTCTTAAACTCTGTGCCTGAGG + Intergenic
1184198414 22:42947706-42947728 GCTCTTAGGTATTTTGCCTGAGG - Intronic
950020300 3:9782599-9782621 TCTCTTAGATATTGTGCTGGGGG - Intronic
952975000 3:38686291-38686313 TCTCTTATATTTTGAGACTGGGG + Intergenic
954364331 3:50138279-50138301 CCTCTTAGACCTTGTGCCAGTGG + Intergenic
955362648 3:58288939-58288961 GCACTTAAATTTTGTGCCTTAGG + Intronic
955705681 3:61725405-61725427 TTTTTTAAATTTTTTGCCTGTGG + Intronic
956538102 3:70302423-70302445 TCTCTTATGTTTTATGCCTCAGG - Intergenic
956545327 3:70395007-70395029 TCTCTTAAATTTTGTGCCAAAGG + Intergenic
956754779 3:72373757-72373779 TCTGCTTGCTTTTGTGCCTGAGG - Exonic
957215044 3:77309138-77309160 TTTCTTAGATTTTAAGCCAGTGG - Intronic
957937384 3:86962385-86962407 CCTTTTAAATTTTGTGCCAGAGG + Intronic
959310122 3:104725532-104725554 TCTCTATGAATTTGTCCCTGAGG - Intergenic
959926433 3:111926645-111926667 TTTCTTAGATTTTTTTCCTTTGG - Intronic
960127277 3:114014243-114014265 TATCTTCCATTTTGTCCCTGGGG - Intronic
961987647 3:131154644-131154666 CCTCTTAGATTTTGTGCCTGAGG + Intronic
961987876 3:131157321-131157343 CCCCTTAGATTTTGCGCCTGAGG + Intronic
965014422 3:163139046-163139068 CCTCTTAGATTTTTTCCCTGTGG + Intergenic
965208437 3:165751811-165751833 TCTCTTAGCTTTGCTGTCTGCGG - Intergenic
965480334 3:169210910-169210932 TCTCTTAGAGTTTGTGCTGAGGG - Intronic
965648053 3:170905260-170905282 TATTTAAAATTTTGTGCCTGAGG + Intronic
968253143 3:197241341-197241363 TCTCTTAGCTTTTGTTTGTGTGG - Intronic
968979802 4:3841129-3841151 CCCCTTAAATTCTGTGCCTGAGG + Intergenic
971335701 4:25721957-25721979 TCTGTTATATTTTGTTCCTGGGG + Intergenic
971971434 4:33625845-33625867 TCTCATCTATTCTGTGCCTGAGG + Intergenic
972658061 4:41085281-41085303 TCTCTGAGATTATGTGCCATAGG - Intronic
974074370 4:57155278-57155300 TTTCTTATATTTAGTACCTGGGG + Intergenic
974688511 4:65265455-65265477 TCACTTAGCTTTTGTGTCAGTGG + Intergenic
975827805 4:78338208-78338230 TCTCTAAAATTTTGTGTCTGGGG - Intronic
976002240 4:80386845-80386867 TCTCTTACAGTTTGTCCTTGAGG + Intronic
977574501 4:98661699-98661721 TCATTTAGAGTTTCTGCCTGGGG + Intergenic
979907808 4:126318188-126318210 TTTCTTAGATTTTGTCCATATGG - Intergenic
980465214 4:133168347-133168369 TCATTTAAAATTTGTGCCTGTGG + Intronic
980495480 4:133584603-133584625 TCTTTTAGCTTTGCTGCCTGTGG - Intergenic
981025250 4:140071250-140071272 TCTCTCAGATGGTGTTCCTGAGG - Intronic
982282722 4:153701914-153701936 TCTCTCAGATTCTGTGAATGTGG + Exonic
982897450 4:160950602-160950624 TCTATTAGATTATATGACTGAGG - Intergenic
984914949 4:184714204-184714226 TCTCTCAGATTTTGTTTCTCTGG - Intronic
985984214 5:3500740-3500762 TCTTTTAGGTTTTGTGCTTTTGG - Intergenic
986080469 5:4386666-4386688 TCTATTTAATTTTGTGCCTAAGG + Intergenic
986850632 5:11808667-11808689 TCTATCAGAGTTTCTGCCTGTGG - Intronic
986993036 5:13575929-13575951 GCTCTTACATTGTTTGCCTGAGG - Intergenic
987487789 5:18542552-18542574 TATTTTAGTTTTTGTGACTGAGG - Intergenic
987771891 5:22315801-22315823 GCTTTTAGATTTTGTGATTGAGG + Intronic
989302654 5:39912246-39912268 TCACTTACCTTCTGTGCCTGTGG - Intergenic
989456125 5:41646491-41646513 CATCTTAAATTTTGAGCCTGAGG - Intergenic
990100251 5:52175790-52175812 TCTATTTGATTTTGTGGCTATGG + Intergenic
991040978 5:62175136-62175158 TCTCTTAGTTTTTGTGAATCAGG - Intergenic
991048335 5:62246177-62246199 GCCCTTACATTTTCTGCCTGAGG - Intergenic
991095429 5:62734861-62734883 TCTCTTATGTTTAGTGACTGGGG - Intergenic
992393035 5:76346966-76346988 TCTCTTAGAGTCTGTTTCTGGGG - Intronic
992706898 5:79405016-79405038 CCTCTTCGATTCTGTGCGTGAGG + Intronic
993001428 5:82385115-82385137 TGTCCTAGTATTTGTGCCTGTGG + Intronic
994374072 5:98998050-98998072 TCTCTTACATTGTTTGTCTGGGG - Intergenic
995138777 5:108709430-108709452 TGTGTTATATTTTGTGACTGAGG - Intergenic
995558837 5:113358943-113358965 TGTCTTAAAATCTGTGCCTGTGG + Intronic
995615745 5:113961093-113961115 CCCCTTAAATTTTGTGCCTGAGG - Intergenic
996099720 5:119433984-119434006 TCTCTCATATTGTGGGCCTGTGG + Intergenic
996612478 5:125399226-125399248 TAGCTTAAGTTTTGTGCCTGAGG + Intergenic
996707948 5:126515797-126515819 TCTCTTAAATTTAGTGGCTGGGG - Intergenic
996708466 5:126520740-126520762 TCTCCTAGATTTAGTGTCTGGGG - Intergenic
998993844 5:147849129-147849151 CCTTTTAGATTTTGCACCTGAGG + Intergenic
999308508 5:150536085-150536107 TTTCTTAGCTTTTGTGACAGAGG + Intronic
1000261960 5:159596739-159596761 TCCCTTAGATTCAGTGGCTGGGG + Intergenic
1000662919 5:163958348-163958370 TCTTTTAGTTTTTGTTCCTTAGG + Intergenic
1001089370 5:168726182-168726204 TCTCTTGGCTTTTCTGTCTGAGG - Intronic
1001281944 5:170392317-170392339 TCTCGTGGATTTTGTGGCTCTGG - Intronic
1002956459 6:1870027-1870049 TCTCTCACAGGTTGTGCCTGGGG + Intronic
1004442270 6:15664783-15664805 TCCCGTAAATTTTGTACCTGAGG - Intergenic
1004814548 6:19298773-19298795 TCTCTGTTATTTTGTGCATGAGG + Intergenic
1006495840 6:34422753-34422775 GCTCTTAAAGTTTGTGCCTTAGG - Intronic
1007317964 6:41004533-41004555 TCTCTTGGCTTTTATTCCTGAGG + Intergenic
1008234792 6:49031496-49031518 TCTCCTATATTTCATGCCTGTGG - Intergenic
1008237632 6:49069425-49069447 TGTTTGAGATTCTGTGCCTGTGG - Intergenic
1009352943 6:62705727-62705749 TCTCTTAGATTTTGTTTGTCTGG + Intergenic
1009893862 6:69722228-69722250 TCTCTTAGCTTTTGTTTCTCTGG - Intronic
1010207871 6:73339117-73339139 TTTCTTAGATTTGGGGCCTCAGG - Intergenic
1010334885 6:74668986-74669008 TCTATTTGATTTTCTGCCTTTGG + Intergenic
1011741008 6:90360636-90360658 TCTCTTCAATTTTCTTCCTGGGG - Intergenic
1012341431 6:98130094-98130116 TTTCCTAGAATTTGTGCCTGTGG - Intergenic
1012868977 6:104651617-104651639 TCTCCTACATTTTATGCATGAGG + Intergenic
1013018017 6:106178834-106178856 CCTCTGAGTTTTTGTTCCTGTGG + Intergenic
1013591511 6:111622790-111622812 ACTCTTAGCTTGTGTGACTGAGG - Intergenic
1013745740 6:113344071-113344093 GCTCTGAGATTCTGTGCCTGAGG - Intergenic
1014221657 6:118804519-118804541 CCCCTTAAATTCTGTGCCTGAGG + Intergenic
1014795161 6:125716514-125716536 TCTCTAAGAATTTTTACCTGGGG + Intergenic
1014959583 6:127666977-127666999 TTTCTTAGATTTTTGGACTGTGG - Intergenic
1015634373 6:135261483-135261505 CCCCTTAAATTTTGTGCCTGGGG + Intergenic
1016484537 6:144522262-144522284 TCTTTTACAATTTGTGCCAGGGG + Intronic
1018714622 6:166522038-166522060 TGTGTCAGATTTTGTGCCTGGGG - Intronic
1019666535 7:2254737-2254759 TCTCACAGAGATTGTGCCTGGGG - Exonic
1019987924 7:4671481-4671503 TCTCTTAGATTTTTAGGCTATGG + Intergenic
1021519267 7:21522897-21522919 TCTCTTAGATTGTTTGCTTCAGG + Intergenic
1022375593 7:29807766-29807788 TCTCTTCGCCTCTGTGCCTGGGG + Intronic
1023603115 7:41900150-41900172 TCTCTTTTATTTTCTGTCTGAGG + Intergenic
1024026220 7:45412209-45412231 TCTCCTTGATTTTGTTCATGTGG + Intergenic
1027751039 7:82147400-82147422 TCTGGGAGATTTGGTGCCTGAGG - Intronic
1027759020 7:82253934-82253956 TCCCCTAGATTCTGTGCTTGAGG + Intronic
1029039003 7:97553389-97553411 TGTCCCAGATTCTGTGCCTGAGG + Intergenic
1030024139 7:105305671-105305693 CCTCTTAGATTCAGTGGCTGGGG + Intronic
1030712613 7:112768679-112768701 TCCCTTATGTTTTGTGCCTGAGG + Intronic
1030960302 7:115912140-115912162 TCTCTTCAAATTTGGGCCTGTGG + Intergenic
1031081728 7:117264944-117264966 ACTCTGTGATTTTCTGCCTGTGG - Intergenic
1032859515 7:135863958-135863980 CCTCTTAAATGTTGTGTCTGAGG + Intergenic
1032989547 7:137377484-137377506 CCTCTTAGCTTTTGTGCATCTGG + Intergenic
1035950445 8:4014221-4014243 TCTGTTAGATTTTTTTCCTAAGG - Intronic
1037512218 8:19595009-19595031 TATATGAGATTTTGTGTCTGCGG + Intronic
1038360733 8:26873410-26873432 TCTCTTAGATTTTGCTCTTCTGG + Intergenic
1038608094 8:29030648-29030670 TCTCTGAGATTCTGTGGCTTTGG + Intronic
1039348536 8:36734818-36734840 TCCCTTAAATTTTGAGCCTGAGG - Intergenic
1039426658 8:37492159-37492181 GCACTTAGATTTTCAGCCTGGGG - Intergenic
1039855135 8:41405541-41405563 CCCCTTAAATTTTGTGCCTGAGG - Intergenic
1039943121 8:42108253-42108275 TCTCTGAGATTTTGGGCAAGAGG - Intergenic
1041251298 8:55937234-55937256 CCTCTTAGATTTTTTTCCTGTGG + Intronic
1042100424 8:65270570-65270592 TCTCTTAGATTTTGAGTCCAGGG - Intergenic
1043371492 8:79599172-79599194 TGTCTTAGATTTTGTTTCTCGGG - Intergenic
1043681572 8:83033463-83033485 TCTCTAATATTTTTTGCATGTGG + Intergenic
1044082118 8:87897976-87897998 CCTATTAGTTTTTGTCCCTGTGG + Intergenic
1044219497 8:89652152-89652174 TCTCTTAGTGTTTGTCCTTGTGG - Intergenic
1044488477 8:92782933-92782955 CTCCTTAAATTTTGTGCCTGAGG - Intergenic
1046704870 8:117438587-117438609 TACCTTAAATTTTGTACCTGAGG - Intergenic
1047479225 8:125264993-125265015 CCCCTTAAGTTTTGTGCCTGAGG - Intronic
1050008718 9:1162789-1162811 TTTCTTATATTTTGTGGCTTAGG + Intergenic
1050612698 9:7369619-7369641 TCTGTGACATGTTGTGCCTGTGG + Intergenic
1051708523 9:19905752-19905774 CCTCTTAGGTTTAGTTCCTGAGG + Intergenic
1055074317 9:72198013-72198035 GCTTTTAAATTTTGTGCCTGAGG - Intronic
1055195192 9:73582330-73582352 ACCCTTAGGTTCTGTGCCTGAGG + Intergenic
1056119588 9:83473971-83473993 TTTCTTAGAGGTTGTGACTGAGG + Intronic
1056208091 9:84339630-84339652 CCTCTTAGGTTGAGTGCCTGAGG - Intronic
1056395980 9:86181520-86181542 TCTCTTAGGTTTAGTAACTGGGG + Intergenic
1056774399 9:89500252-89500274 TCTATTAGATTCTGAGCATGTGG - Intergenic
1057587919 9:96346141-96346163 CCTCTTAGATTCAGTGTCTGGGG + Intronic
1061168998 9:128941271-128941293 TAGCTTAGCTTTTGTCCCTGAGG + Intronic
1062199789 9:135296342-135296364 CCTCTTAGGTTTGGTACCTGGGG + Intergenic
1185777201 X:2812899-2812921 GCCCTTACATTTTGTGCTTGTGG - Intronic
1185925409 X:4140283-4140305 TCCCTTAAATTTTCGGCCTGAGG + Intergenic
1186568959 X:10694493-10694515 ACTCTTAGGTTTGGTGCCTGGGG - Intronic
1187140554 X:16589248-16589270 CCCCTTAAATTTTGTGCCTGAGG + Exonic
1187171184 X:16853828-16853850 TCTCTTAGACTGTTTGTCTGTGG - Exonic
1188072781 X:25737352-25737374 TCTCTTTGTTTTTATGCCTGAGG - Intergenic
1189202214 X:39206143-39206165 CCCCTTAAATTTTGTACCTGAGG - Intergenic
1189553394 X:42116026-42116048 TTTCTTAAATTTTGCACCTGAGG - Intergenic
1189573435 X:42324198-42324220 TCTCTTTGATTTGGTCCGTGAGG - Intergenic
1189860223 X:45264102-45264124 TCCCTTAAATTTTGTGCAAGAGG + Intergenic
1191859322 X:65653092-65653114 TCTCTAAGACTTTGGGACTGGGG - Intronic
1192131354 X:68554318-68554340 CCACTTAAGTTTTGTGCCTGAGG + Intergenic
1192841374 X:74859448-74859470 TCTCTTAGCTTTTGTTTGTGTGG - Intronic
1193178328 X:78422046-78422068 TCTCTTAGATTTTGTTTGTCTGG - Intergenic
1193407708 X:81122487-81122509 AAGCTTAAATTTTGTGCCTGAGG - Intronic
1193995314 X:88359775-88359797 TTTCTTAGATATGGTACCTGAGG + Intergenic
1194757562 X:97755300-97755322 TCTTTTAGATTTTGTTCCTGGGG + Intergenic
1195073501 X:101303985-101304007 TCTCTTAGATTTGCTTTCTGAGG + Intergenic
1196100688 X:111844402-111844424 TCCCTTAAATTGTATGCCTGAGG + Intronic
1197953356 X:131920992-131921014 TCTCTCAGATTTTGTTTCTCTGG - Intergenic
1198173277 X:134128936-134128958 TCCCTTAAATTTTGTGCCTTAGG - Intergenic
1198420905 X:136470203-136470225 TCCCTTAGATTTAGTGGTTGAGG + Intergenic
1200396304 X:155990633-155990655 TCTCTCAGCTTTTGTTTCTGTGG - Intergenic
1201292817 Y:12438555-12438577 GCCCTTATATTTTGTGCTTGTGG + Intergenic