ID: 917087316

View in Genome Browser
Species Human (GRCh38)
Location 1:171316916-171316938
Sequence TCTCTTAGATTTTGTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 2, 2: 3, 3: 43, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917087312_917087316 -7 Left 917087312 1:171316900-171316922 CCTCCAGTCAGTAAATTCTCTTA 0: 1
1: 0
2: 1
3: 10
4: 151
Right 917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG 0: 1
1: 2
2: 3
3: 43
4: 267
917087310_917087316 23 Left 917087310 1:171316870-171316892 CCTGGAGGACTCAGGAGTCTTTC 0: 1
1: 0
2: 3
3: 11
4: 197
Right 917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG 0: 1
1: 2
2: 3
3: 43
4: 267
917087311_917087316 -6 Left 917087311 1:171316899-171316921 CCCTCCAGTCAGTAAATTCTCTT 0: 1
1: 0
2: 0
3: 24
4: 289
Right 917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG 0: 1
1: 2
2: 3
3: 43
4: 267
917087313_917087316 -10 Left 917087313 1:171316903-171316925 CCAGTCAGTAAATTCTCTTAGAT 0: 1
1: 1
2: 0
3: 6
4: 163
Right 917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG 0: 1
1: 2
2: 3
3: 43
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917087316 Original CRISPR TCTCTTAGATTTTGTGCCTG GGG Intronic