ID: 917088689

View in Genome Browser
Species Human (GRCh38)
Location 1:171329670-171329692
Sequence TGTCATGTTGACATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917088689 Original CRISPR TGTCATGTTGACATGGAGCC AGG (reversed) Intronic
900733431 1:4278759-4278781 TGTGATGTTGACAAAGAACCTGG + Intergenic
902875358 1:19337719-19337741 GGTCATGTTGGCAAGGTGCCTGG - Intergenic
902875379 1:19337801-19337823 GGTCATGTTGGCAAGGTGCCTGG - Intergenic
904895096 1:33811190-33811212 TGTCAGGTTGACATAAAGCTAGG + Intronic
905221682 1:36452146-36452168 TGTCATGTTGACAGTGATGCTGG - Intergenic
906946362 1:50297795-50297817 TCTGATGTTGACATGGCGGCCGG - Intergenic
907654895 1:56332435-56332457 AGTCATGTTGACAGGGGGCGTGG + Intergenic
907787907 1:57631890-57631912 TGTCCTGGTAACATGGAGCAGGG - Intronic
910284920 1:85543129-85543151 GGTTATGTTCACAAGGAGCCAGG + Intronic
912166530 1:107048089-107048111 TGGCATGTAGAGATGGAGGCAGG - Intergenic
912774874 1:112499975-112499997 GGTCATGTTGACATGAACCAGGG + Intronic
917088689 1:171329670-171329692 TGTCATGTTGACATGGAGCCAGG - Intronic
917912269 1:179661999-179662021 TGTCATCTTTACCTGGAGTCAGG + Intronic
920253469 1:204638216-204638238 TGTCATGGTGATCTGGGGCCAGG + Intronic
923021271 1:230165984-230166006 GATCAGGTTGACATGGAGTCTGG + Intronic
924161830 1:241240906-241240928 TGTCAGGTTGTCCTGAAGCCTGG - Intronic
1064005887 10:11698671-11698693 TGTTATGTAGAGATGGAGTCTGG + Intergenic
1064584597 10:16827611-16827633 TGTTATTTTGAGATGGAGTCTGG + Intronic
1065534470 10:26703784-26703806 TGTCATTTTAATATGGCGCCGGG + Intronic
1065850625 10:29784564-29784586 CCTGATGTTGACATGTAGCCCGG + Intergenic
1066230123 10:33424069-33424091 TGTCATGGTGTGAGGGAGCCTGG + Intergenic
1068827282 10:61453614-61453636 TGTCATGCTGACCCGAAGCCGGG + Intergenic
1070574564 10:77667777-77667799 TCTCATTGAGACATGGAGCCTGG - Intergenic
1070617202 10:77978230-77978252 TGCCAGGTTGACATGGGGCTTGG - Intronic
1071521905 10:86336723-86336745 AGCCATGTTCCCATGGAGCCAGG - Intronic
1072574242 10:96685724-96685746 GGACATGTGGACATGGACCCTGG - Intronic
1077431460 11:2517840-2517862 TGTGCTGTTGGCATGCAGCCTGG + Intronic
1078018541 11:7636208-7636230 TTTCATATGGACATGGAGGCAGG - Intronic
1086137267 11:83454474-83454496 TGTCATATTGACATTTAGCCAGG - Intergenic
1086938902 11:92774791-92774813 TGTGATTCTGACATGCAGCCAGG + Intronic
1086938984 11:92775778-92775800 TGTGATTCTGACATGCAGCCAGG + Intronic
1087092439 11:94287473-94287495 TGTCATTTTGAGATGGGGCCTGG - Intergenic
1090258705 11:125303590-125303612 TGTGATGGAGTCATGGAGCCGGG - Intronic
1092031744 12:5292223-5292245 TGTAATGTTGATTTGGAGTCAGG + Intergenic
1092368877 12:7899842-7899864 TTTTATTTTGACATGGAGTCTGG - Intergenic
1096244553 12:49976812-49976834 TGTAATGCTGACAGAGAGCCTGG - Exonic
1097964223 12:65561982-65562004 TGTCAGGTTCTCATGGAGGCAGG - Intergenic
1100380170 12:94054454-94054476 TGTCCTGTCCCCATGGAGCCAGG - Intergenic
1101306184 12:103530262-103530284 TGTCAGCTGCACATGGAGCCCGG + Intergenic
1102903224 12:116655258-116655280 TGTTCTGTTGACATGCAGCTAGG + Intergenic
1103121947 12:118388022-118388044 TGTCATTTTGACTTGGTGCAAGG + Intronic
1112941517 13:104867643-104867665 TGTCATGTTCTCATGGAGAGTGG + Intergenic
1118208931 14:63749040-63749062 TGTGATGTTTACATAGAGCATGG - Intergenic
1119425659 14:74533359-74533381 TGGCATGTTGAGATGCAGACAGG + Intronic
1119821357 14:77618787-77618809 TTTCCTGTTTACATGGAGTCTGG - Intergenic
1122270124 14:100565249-100565271 TGTCATGTGGACAAGAAGGCAGG + Intronic
1126261466 15:46697844-46697866 TGTCTTCTTGATGTGGAGCCTGG + Intergenic
1126872329 15:53002861-53002883 TGTCTTGTTTACTTGGAACCTGG + Intergenic
1127688073 15:61367993-61368015 TGCCATGGTGACATGGAGGAAGG + Intergenic
1128785897 15:70396812-70396834 AGGCATTCTGACATGGAGCCCGG - Intergenic
1128788655 15:70416565-70416587 TGTGATGTTGAAGGGGAGCCTGG + Intergenic
1130106738 15:80934515-80934537 TGTCAGGTTCACAGTGAGCCAGG + Intronic
1133332452 16:4983012-4983034 TTTTATTTTGAGATGGAGCCTGG + Intronic
1136098634 16:27977025-27977047 TGTCATGTTGCCTTAGAGCCAGG + Intronic
1136671930 16:31866148-31866170 TGTAATATTCACATGCAGCCTGG - Intergenic
1136991235 16:35152446-35152468 TCTCTTGTTGACTTGGAGACTGG + Intergenic
1138067049 16:53953150-53953172 TGTCATTTCGACTTGAAGCCAGG + Intronic
1143393432 17:6574120-6574142 TGTCATGCAGACATGGGGACAGG - Intergenic
1143403744 17:6662451-6662473 TGTGAGCTCGACATGGAGCCAGG - Intergenic
1143505887 17:7364943-7364965 TGTCCTCTTGACATGGTGGCTGG + Intergenic
1151195076 17:72425553-72425575 TGTCCTGCTGGCATGGAGCTTGG - Intergenic
1152540246 17:80971175-80971197 TGTCTTGGGGACATGAAGCCTGG - Intergenic
1154496634 18:14966069-14966091 TGTTATGTTTGCAGGGAGCCTGG - Intergenic
1155293969 18:24368882-24368904 TCTCATGTTGAATTGGAGCAGGG + Intronic
1161194712 19:2980020-2980042 TGCCATGTTGAGGTGGAGACCGG + Intronic
1161826937 19:6574052-6574074 TGTGATGTTTACATGGTGCGTGG + Intergenic
1161931951 19:7346579-7346601 TGTCATGTGGACATGCAGAATGG - Intergenic
1162543993 19:11317101-11317123 TGTCTTGTAGAGATGGAGTCAGG - Intronic
1166996082 19:46720276-46720298 TGTCTGTTTGCCATGGAGCCTGG - Exonic
1167682830 19:50935657-50935679 TGTCTTTTTAACATGGAGGCTGG - Intergenic
1168198139 19:54790905-54790927 TGTCATGTTGTCATCTAGCTTGG - Intronic
1168548299 19:57272135-57272157 TGTCTTGTTCTCATGGAGTCAGG - Intergenic
924999570 2:394154-394176 TGTGCCGTTGCCATGGAGCCTGG + Intergenic
925872802 2:8285444-8285466 TGGCTTGTTTACATGAAGCCGGG + Intergenic
926639287 2:15218617-15218639 TGTCATGTTGGCCAGGTGCCAGG + Intronic
926714408 2:15912815-15912837 TATTATTTTGAGATGGAGCCTGG + Intergenic
929612962 2:43285265-43285287 TCTCATGTTGAATTGGAGGCGGG + Intronic
929860774 2:45675631-45675653 TGGCATGTTGAAAAGGAGCAGGG - Intronic
929905418 2:46041840-46041862 CGACATGTTAACATGGAGGCTGG - Intronic
930227539 2:48809515-48809537 TGTAATGTTGACATGATGGCTGG + Intergenic
931714282 2:65016706-65016728 AGCCATGTTAACATGGAACCAGG + Intronic
933334009 2:80930902-80930924 TGTCATGTTGAATTGGAGGAGGG - Intergenic
937077524 2:119117824-119117846 TCTCCTGGTGACCTGGAGCCAGG + Intergenic
943304330 2:186241207-186241229 TGACATGTTGACATGGTGAACGG + Intergenic
945942882 2:215967244-215967266 TATCATGTTGACAAAGAGGCAGG - Intronic
945971783 2:216237961-216237983 TGGCAGGTGGTCATGGAGCCAGG + Intergenic
946471172 2:219962745-219962767 TGTCAGGGTGAGATGGAGCATGG + Intergenic
947356092 2:229297249-229297271 TGTCTTGTTGAAATGCAGGCTGG + Intergenic
1171142344 20:22754133-22754155 TGTCTTGTTTCCATGGTGCCTGG - Intergenic
1174852124 20:54005824-54005846 TGTCAAGTGGACATGGAGGAAGG + Intronic
1175111960 20:56654696-56654718 GATCCTGTTGAAATGGAGCCAGG + Intergenic
1178422438 21:32453094-32453116 TTTCATGTTGACATGGAAGGGGG - Intronic
1182978252 22:34643512-34643534 TCTCATGTTGACAATGTGCCAGG + Intergenic
1184320459 22:43738845-43738867 TCTCATGTGGGGATGGAGCCAGG - Intronic
950326455 3:12114869-12114891 TCTCATGTTAGCTTGGAGCCTGG - Intronic
950934575 3:16825548-16825570 TGTAAAGTAGCCATGGAGCCGGG + Intronic
951375270 3:21907013-21907035 AGTGATATTGACATGGATCCTGG - Intronic
954277860 3:49554317-49554339 TATCATGCTGAGAAGGAGCCGGG - Intergenic
954614486 3:51962636-51962658 TGTCATGTTGGGATGGGGCAGGG - Intronic
957935140 3:86932583-86932605 TGTCATGGTGCCAGGGAGCACGG + Intergenic
961198780 3:125027239-125027261 TGTCCTGTAGAAATGCAGCCAGG + Exonic
964374167 3:156033298-156033320 AGTCCTGTAGGCATGGAGCCTGG + Intergenic
964476139 3:157099687-157099709 TGTCTTGTTGTCATGGTGCTAGG + Intergenic
966420572 3:179730727-179730749 TGCCATGTTGACATGTAGGTAGG + Intronic
966713548 3:182993108-182993130 TGTCGTTTTGAGATGGAGTCTGG + Intergenic
967172530 3:186833312-186833334 TCTCATATTGACATAGAGCCTGG - Intergenic
967682907 3:192385855-192385877 GGGCATGTTTACCTGGAGCCTGG - Intronic
968500746 4:948729-948751 TGTCATGAGGACACAGAGCCAGG - Intronic
968765309 4:2465301-2465323 AGTCATGCTCACATGGGGCCTGG - Intronic
969430228 4:7149628-7149650 TGACTAGTTGACATGAAGCCCGG - Intergenic
969695297 4:8730864-8730886 AGGCATGTTCACCTGGAGCCCGG + Intergenic
972023958 4:34352940-34352962 TGGGATGTTGACTTGAAGCCAGG - Intergenic
974882344 4:67775066-67775088 TTTCATGTTGACATGCTTCCGGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977676545 4:99754701-99754723 TTTCATATGGACATGGAACCAGG + Intergenic
979465390 4:121031780-121031802 TGTCATCTAGACGTTGAGCCAGG - Intergenic
980245782 4:130239467-130239489 TATCATGTTGACTTGTAACCTGG - Intergenic
985230640 4:187812373-187812395 TGTCATGATGAAATGAAACCAGG + Intergenic
986052753 5:4105275-4105297 TGTCAAGTAGAAATGGAGCAAGG + Intergenic
986797308 5:11224486-11224508 TGTCATGTTTAAATACAGCCAGG - Intronic
987433262 5:17862730-17862752 AGCCATGTTGACATGGAGGATGG - Intergenic
989964081 5:50448748-50448770 TGTCTTGATGGCATGGATCCTGG + Intergenic
992008884 5:72507768-72507790 TGTCATGTCGACTTAGAGCAAGG + Intergenic
997044294 5:130295036-130295058 AGTCATGTTTACATGGTGGCAGG - Intergenic
998853986 5:146377252-146377274 TGTCATGATGGCATGGAGTAAGG - Intergenic
999941601 5:156548915-156548937 TGTGATGTTTACCTGGAGACAGG - Intronic
1001682989 5:173572426-173572448 TGTAATGATGACAGGGAGGCAGG + Intergenic
1001838431 5:174852541-174852563 AGACATGTTGCCCTGGAGCCAGG - Intergenic
1003956505 6:11170240-11170262 GGTCATGTTGACAGAGAGCATGG + Intergenic
1006323821 6:33337940-33337962 TGTTTTTTTGAGATGGAGCCTGG - Intergenic
1007575560 6:42923342-42923364 TGTCAGGTGGGGATGGAGCCTGG + Exonic
1009712150 6:67337755-67337777 TGACATGGTGGCATGGAGCAGGG - Intergenic
1009740485 6:67737243-67737265 TGTCATGTGGACATGGGCCTTGG - Intergenic
1012426066 6:99115994-99116016 TATTATGTTCACCTGGAGCCAGG + Intergenic
1013926993 6:115485162-115485184 TATCATGGTTACCTGGAGCCAGG + Intergenic
1015446351 6:133310030-133310052 TGTGATGTTGTGAGGGAGCCTGG + Intronic
1016063334 6:139653323-139653345 TGTCAACTTGACAGGGAGCTTGG + Intergenic
1016293130 6:142545295-142545317 TTTGATGTAGACATGGAGGCAGG - Intergenic
1024026566 7:45414372-45414394 GGTCAGGGTGACCTGGAGCCAGG + Intergenic
1024500582 7:50101144-50101166 TCCCATGTTGACATTGGGCCTGG + Intronic
1028732884 7:94173023-94173045 TGTCATGTTGTGAGAGAGCCAGG + Intergenic
1028905116 7:96144933-96144955 TGTCATTTTGACAAGATGCCAGG - Intronic
1035011007 7:155714870-155714892 TGTCCTGTGGCCATGGAGCAGGG + Intronic
1038533888 8:28339981-28340003 TTTAATGTTTCCATGGAGCCAGG - Intronic
1039251394 8:35668808-35668830 CTTCTTGTTGAAATGGAGCCTGG + Intronic
1040537955 8:48325922-48325944 GGTCATGTTGGCATGAAGCAGGG + Intergenic
1041376000 8:57209867-57209889 TGTCAGGTTGACATTGAACGTGG - Intergenic
1048180355 8:132188912-132188934 TTACATGTTGACCTGGAGTCTGG + Intronic
1049650145 8:143762568-143762590 TGTCATGTCCACAGGGAGCTTGG - Intergenic
1051133675 9:13893021-13893043 TCTTATGATGACATGGAGTCAGG + Intergenic
1051897230 9:22000180-22000202 GGTGATTCTGACATGGAGCCAGG + Intronic
1053355102 9:37438742-37438764 AGTCATGTTGACATGGTGTTAGG - Exonic
1053529154 9:38861095-38861117 TGTTATTTTGAGATGGAGTCTGG - Intergenic
1054201379 9:62085524-62085546 TGTTATTTTGAGATGGAGTCTGG - Intergenic
1054636980 9:67502836-67502858 TGTTATTTTGAGATGGAGTCTGG + Intergenic
1054878368 9:70120236-70120258 TGTGATGCAGAGATGGAGCCTGG - Intronic
1055302244 9:74893610-74893632 TGTCATGTTGTCATTCAGGCTGG - Intergenic
1057007773 9:91575733-91575755 TCTGATGGTGACATGGAGCTAGG - Intronic
1057326941 9:94074365-94074387 TGTCATGTTGCCTTTGAGTCGGG + Intronic
1057406203 9:94773066-94773088 TGCCATGTTGACATGGCAACGGG - Exonic
1058693636 9:107540390-107540412 TGGCATGTTCACTTGGAGCCAGG + Intergenic
1059477418 9:114558922-114558944 TGTCACGTTAACAGGGACCCTGG - Intergenic
1059504108 9:114782227-114782249 TGGCTTATTGACTTGGAGCCAGG + Intergenic
1186396782 X:9217325-9217347 TGTCCTCATGACATGGTGCCTGG - Intergenic
1188472672 X:30558022-30558044 TGCCCTCTTGACCTGGAGCCAGG - Intergenic
1189768125 X:44392969-44392991 TGACATGGTCACATGGAGCCTGG - Intergenic
1192868426 X:75161335-75161357 TGGCATGGTGACAAGGAGCATGG - Intergenic
1194904507 X:99557977-99557999 TGCATTGTGGACATGGAGCCAGG + Intergenic
1199759478 X:150894286-150894308 TGTCTTGCTCACTTGGAGCCAGG + Intronic