ID: 917099495

View in Genome Browser
Species Human (GRCh38)
Location 1:171431166-171431188
Sequence GCTCCCAGAAGCACTTACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917099495_917099504 22 Left 917099495 1:171431166-171431188 CCAAGGTAAGTGCTTCTGGGAGC No data
Right 917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG No data
917099495_917099503 21 Left 917099495 1:171431166-171431188 CCAAGGTAAGTGCTTCTGGGAGC No data
Right 917099503 1:171431210-171431232 TGGCCCCTGGCAGCATCTTGGGG No data
917099495_917099499 8 Left 917099495 1:171431166-171431188 CCAAGGTAAGTGCTTCTGGGAGC No data
Right 917099499 1:171431197-171431219 GCAGAACTCCATGTGGCCCCTGG No data
917099495_917099502 20 Left 917099495 1:171431166-171431188 CCAAGGTAAGTGCTTCTGGGAGC No data
Right 917099502 1:171431209-171431231 GTGGCCCCTGGCAGCATCTTGGG No data
917099495_917099501 19 Left 917099495 1:171431166-171431188 CCAAGGTAAGTGCTTCTGGGAGC No data
Right 917099501 1:171431208-171431230 TGTGGCCCCTGGCAGCATCTTGG No data
917099495_917099498 1 Left 917099495 1:171431166-171431188 CCAAGGTAAGTGCTTCTGGGAGC No data
Right 917099498 1:171431190-171431212 GACAGGAGCAGAACTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917099495 Original CRISPR GCTCCCAGAAGCACTTACCT TGG (reversed) Intergenic
No off target data available for this crispr