ID: 917099497

View in Genome Browser
Species Human (GRCh38)
Location 1:171431188-171431210
Sequence ACATGGAGTTCTGCTCCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917099497_917099502 -2 Left 917099497 1:171431188-171431210 CCGACAGGAGCAGAACTCCATGT No data
Right 917099502 1:171431209-171431231 GTGGCCCCTGGCAGCATCTTGGG No data
917099497_917099509 27 Left 917099497 1:171431188-171431210 CCGACAGGAGCAGAACTCCATGT No data
Right 917099509 1:171431238-171431260 TGCAACCCCTAGAGCCCCAGAGG No data
917099497_917099504 0 Left 917099497 1:171431188-171431210 CCGACAGGAGCAGAACTCCATGT No data
Right 917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG No data
917099497_917099510 28 Left 917099497 1:171431188-171431210 CCGACAGGAGCAGAACTCCATGT No data
Right 917099510 1:171431239-171431261 GCAACCCCTAGAGCCCCAGAGGG No data
917099497_917099501 -3 Left 917099497 1:171431188-171431210 CCGACAGGAGCAGAACTCCATGT No data
Right 917099501 1:171431208-171431230 TGTGGCCCCTGGCAGCATCTTGG No data
917099497_917099503 -1 Left 917099497 1:171431188-171431210 CCGACAGGAGCAGAACTCCATGT No data
Right 917099503 1:171431210-171431232 TGGCCCCTGGCAGCATCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917099497 Original CRISPR ACATGGAGTTCTGCTCCTGT CGG (reversed) Intergenic
No off target data available for this crispr