ID: 917099504

View in Genome Browser
Species Human (GRCh38)
Location 1:171431211-171431233
Sequence GGCCCCTGGCAGCATCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917099497_917099504 0 Left 917099497 1:171431188-171431210 CCGACAGGAGCAGAACTCCATGT No data
Right 917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG No data
917099495_917099504 22 Left 917099495 1:171431166-171431188 CCAAGGTAAGTGCTTCTGGGAGC No data
Right 917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917099504 Original CRISPR GGCCCCTGGCAGCATCTTGG GGG Intergenic
No off target data available for this crispr