ID: 917099715

View in Genome Browser
Species Human (GRCh38)
Location 1:171432753-171432775
Sequence TTTGTATCTGTAGGGACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917099715_917099721 17 Left 917099715 1:171432753-171432775 CCCTTGGTCCCTACAGATACAAA No data
Right 917099721 1:171432793-171432815 CTGTGGCCTCATAGAGCTGATGG No data
917099715_917099719 0 Left 917099715 1:171432753-171432775 CCCTTGGTCCCTACAGATACAAA No data
Right 917099719 1:171432776-171432798 TGCAAATGTGACTGAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917099715 Original CRISPR TTTGTATCTGTAGGGACCAA GGG (reversed) Intergenic
No off target data available for this crispr