ID: 917099719

View in Genome Browser
Species Human (GRCh38)
Location 1:171432776-171432798
Sequence TGCAAATGTGACTGAGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917099715_917099719 0 Left 917099715 1:171432753-171432775 CCCTTGGTCCCTACAGATACAAA No data
Right 917099719 1:171432776-171432798 TGCAAATGTGACTGAGCCTGTGG No data
917099718_917099719 -9 Left 917099718 1:171432762-171432784 CCTACAGATACAAATGCAAATGT No data
Right 917099719 1:171432776-171432798 TGCAAATGTGACTGAGCCTGTGG No data
917099717_917099719 -8 Left 917099717 1:171432761-171432783 CCCTACAGATACAAATGCAAATG No data
Right 917099719 1:171432776-171432798 TGCAAATGTGACTGAGCCTGTGG No data
917099716_917099719 -1 Left 917099716 1:171432754-171432776 CCTTGGTCCCTACAGATACAAAT No data
Right 917099719 1:171432776-171432798 TGCAAATGTGACTGAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917099719 Original CRISPR TGCAAATGTGACTGAGCCTG TGG Intergenic
No off target data available for this crispr