ID: 917099721

View in Genome Browser
Species Human (GRCh38)
Location 1:171432793-171432815
Sequence CTGTGGCCTCATAGAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917099718_917099721 8 Left 917099718 1:171432762-171432784 CCTACAGATACAAATGCAAATGT No data
Right 917099721 1:171432793-171432815 CTGTGGCCTCATAGAGCTGATGG No data
917099715_917099721 17 Left 917099715 1:171432753-171432775 CCCTTGGTCCCTACAGATACAAA No data
Right 917099721 1:171432793-171432815 CTGTGGCCTCATAGAGCTGATGG No data
917099717_917099721 9 Left 917099717 1:171432761-171432783 CCCTACAGATACAAATGCAAATG No data
Right 917099721 1:171432793-171432815 CTGTGGCCTCATAGAGCTGATGG No data
917099716_917099721 16 Left 917099716 1:171432754-171432776 CCTTGGTCCCTACAGATACAAAT No data
Right 917099721 1:171432793-171432815 CTGTGGCCTCATAGAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917099721 Original CRISPR CTGTGGCCTCATAGAGCTGA TGG Intergenic
No off target data available for this crispr