ID: 917104278

View in Genome Browser
Species Human (GRCh38)
Location 1:171476736-171476758
Sequence CAGTAGGGGTTGAGAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917104278_917104283 9 Left 917104278 1:171476736-171476758 CCTACTTCTCTCAACCCCTACTG No data
Right 917104283 1:171476768-171476790 AGCCTCCTCTCACTACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917104278 Original CRISPR CAGTAGGGGTTGAGAGAAGT AGG (reversed) Intergenic
No off target data available for this crispr