ID: 917104316

View in Genome Browser
Species Human (GRCh38)
Location 1:171477180-171477202
Sequence CTGTTGTTCATAAAGTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917104316_917104319 27 Left 917104316 1:171477180-171477202 CCCTTTTACTTTATGAACAACAG No data
Right 917104319 1:171477230-171477252 CAAACATGCCATGCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917104316 Original CRISPR CTGTTGTTCATAAAGTAAAA GGG (reversed) Intergenic
No off target data available for this crispr