ID: 917104897 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:171482680-171482702 |
| Sequence | TCTCCTTAGCAGCACTTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 917104897_917104900 | 6 | Left | 917104897 | 1:171482680-171482702 | CCATCCAAGTGCTGCTAAGGAGA | No data | ||
| Right | 917104900 | 1:171482709-171482731 | GCACAAATCAGCAGCTCAGCAGG | No data | ||||
| 917104897_917104901 | 24 | Left | 917104897 | 1:171482680-171482702 | CCATCCAAGTGCTGCTAAGGAGA | No data | ||
| Right | 917104901 | 1:171482727-171482749 | GCAGGATGTCACCACTATATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 917104897 | Original CRISPR | TCTCCTTAGCAGCACTTGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||