ID: 917104897

View in Genome Browser
Species Human (GRCh38)
Location 1:171482680-171482702
Sequence TCTCCTTAGCAGCACTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917104897_917104900 6 Left 917104897 1:171482680-171482702 CCATCCAAGTGCTGCTAAGGAGA No data
Right 917104900 1:171482709-171482731 GCACAAATCAGCAGCTCAGCAGG No data
917104897_917104901 24 Left 917104897 1:171482680-171482702 CCATCCAAGTGCTGCTAAGGAGA No data
Right 917104901 1:171482727-171482749 GCAGGATGTCACCACTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917104897 Original CRISPR TCTCCTTAGCAGCACTTGGA TGG (reversed) Intergenic
No off target data available for this crispr